We narrowed to 6,263 results for: 338
-
Plasmid#244169PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hIgGVHSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human IgG-VH SS, human IL-10Rb ECD and TMD, and NTEVp 75S mutant (IL10RB Human, Synthetic)
UseSynthetic BiologyTagshuman IgG VH signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4312 IL-10Rb NTEVp chain (human CD8a SS) in PolyTX-mNeonGreen
Plasmid#244170PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hCD8aSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human CD8a SS, human IL-10Rb ECD and TMD, and NTEVp (75S) (IL10RB Human, Synthetic)
UseSynthetic BiologyTagshuman CD8a signal peptide 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_C1D (pP18(T)_B9-AVA4070)
Plasmid#239296PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting C1DDepositorInsertU6-driven sgRNA targeting C1D (C1D Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Plxnd1 sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239032PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.3 N-MYC ES8L3
Plasmid#227881PurposeUsed for transfection of cells for expression of C-MYC ES8L3DepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_WT-ABD
Plasmid#234553PurposeCTNNA1 M-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa 273-635PromoterCMVAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_L436P
Plasmid#234559PurposeCTNNA1 eye phenotype via forward genetic screenDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG8Ha-FLI1_DBD_R2L2
Plasmid#188049PurposeExpresses His8-FLI1_DBD_R2L2(276-399_R337L_R340L_F362A) with a TEV site for removal of the His8 tag.DepositorInsertFLI1 (FLI1 Human)
TagsHis8ExpressionBacterialMutationdeleted amino acids 1-275, 400-452, mutated R337L…PromoterT7Available SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG8Ha-FLI1_DBD_deltaAlpha4
Plasmid#188050PurposeExpresses His8-FLI1_DBD_deltaAlpha4(276-361) with a TEV site for removal of the His8 tag.DepositorInsertFLI1 (FLI1 Human)
TagsHis8ExpressionBacterialMutationdeleted amino acids 1-275, 362-452PromoterT7Available SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG8Ha-FLI1_DBD(276-399_F362A)
Plasmid#188047PurposeExpresses His8-FLI1_DBD(276-399_F362A) with a TEV site for removal of the His8 tag.DepositorInsertFLI1 (FLI1 Human)
TagsHis8ExpressionBacterialMutationdeleted amino acids 1-275, 400-452, mutated F362APromoterT7Available SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3379
Plasmid#144855PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-SP-ALFA-lk-HiBiT-lk-ADGRL3-L928A-M929A
Plasmid#233065PurposeExpresses tethered-agonist dead mouse ADGRL3-L928A-M929A (UniProt Q80TS3-3). An N-terminal AFLA-tag (SRLEEELRRRLTE) and HiBiT tag (VSGWRLFKKIS) follow the endogenous ADGRL3 signal peptide.DepositorInsertADGRL3 (Adgrl3 Mouse)
TagsALFA and HiBiTExpressionMammalianMutationLeucine 928 to Alanine; Methionine 929 to AlanineAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-DGKδ2
Plasmid#226506PurposeExpress N-terminal three tandem FLAG epitope tags, followed by an enterokinase cleavage site and human DGKD geneDepositorInsertDGKD (DGKD Human)
TagsThree tandem FLAG epitope tag and enterokinase cl…ExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-BCL9
Plasmid#202662PurposeTet-ON 3rd generation expression vector with inducible expression of BCL9 and a puromycin selection cassetteDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RHOA(15))-PGKpuro2ABFP-W
Plasmid#200493PurposeLentiviral vector expressing gRNA targeting human RHOADepositorInsertRHOA(15) (RHOA Human)
UseLentiviralAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RHOA(12))-PGKpuro2ABFP-W
Plasmid#200492PurposeLentiviral vector expressing gRNA targeting human RHOADepositorInsertRHOA(12) (RHOA Human)
UseLentiviralAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_GOLGA3_SLC35E3
Plasmid#205826PurposeExpress mEGFP-tagged fusion protein, GOLGA3_SLC35E3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ABR_DUXA
Plasmid#205767PurposeExpress mEGFP-tagged fusion protein, ABR_DUXA from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only