We narrowed to 8,683 results for: aav
-
Plasmid#230526PurposeAiE2010m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
Plasmid#212829PurposeDoxycycline-inducible (Zim3)KRAB-dCas9-HA-P2A-mCherry cassette for integration at the AAVS1-locus of the human genome.DepositorInsertZIM3-KRAB-dCas9-P2A-mCherry
TagsHA-tag and ZIM3-KRABExpressionBacterial and MammalianPromoterCAG, TetOnAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-CAGGS-Flex/3'USS-GFP(ATG mut)
Plasmid#197885PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP1862 - pAAV-AiE2566m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214561PurposeAiE2566m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP
Plasmid#137140PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE123T, T159CPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BEC enhancer-minBG-iCre(R279T)-4x6T
Plasmid#236727PurposeBrain Endothelial Cell Enhancer with 4x6T miRNA targeting cassette For use in combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors.DepositorInsertscis-regulatory elements 89763
iCre(R297T)
4x6T miRNA targeting cassette
UseAAVMutationR297TAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV SYN flex PSAM4 GlyR IRES EGFP
Plasmid#119741PurposeCre-dependent chemogenetic inhibitor expressionDepositorHas ServiceAAV5 and AAV9InsertPSAM4 GlyR IRES eGFP (CHRNA7 Human, Synthetic)
UseAAVExpressionMammalianMutationL131G, Q139L, Y217FPromotersynapsinAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-EGFP-P2A-EGFPf-WPRE-HGHpA
Plasmid#74513PurposeAAV vector that use human synapsin-1 promoter to drive the expression of EGFP and membrane-targeted EGFPf linked by self-cleaving P2A peptide.DepositorInsertEGFP-p2A-EGFP-f
UseAAVAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE
Plasmid#51509PurposeCan be used to generate AAV virus that will express cytoplasmic tdTomato and presynaptic (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorHas ServiceAAV1InserttdTomato-T2A-SypEGFP
UseAAVPromoterphSyn1Available SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-JNKKTRrsGreenF-E-2A-ERKKTRrsFastLime-IRES-PKAKTRClover-2A-P38KTRDronpa
Plasmid#205766PurposeExpression of JNK KTR rsGreenF-E, ERK KTR rsFastLime, PKA KTR Clover, and P38 KTR Dronpa in mamalian cellsDepositorInsertJNK KTR rsGreenF-E-2A-ERK KTR rsFastLime-IRES-PKA KTR Clover-2A-P38 KTR Dronpa
UseAAVExpressionMammalianMutationwtAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1α-TetOn3G_2x cHS4_pTRE3G-loxP-EGFP-lox2272 [AAVS1]
Plasmid#227246PurposeAll-in-one ROSE LP donor construct for TetOn3G-inducible cell line development in HEK293 cellDepositorInsertsTet-On 3G transactivator protein
Enhanced green fluorescent protein
UseCre/Lox and Synthetic BiologyExpressionMammalianPromoterEF1α and pTRE3GAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-FLEX-NEPLDCV-P2A-mRUBY3-WPRE
Plasmid#207664PurposeNeuropeptide degradationDepositorInsertNEP (MME Human)
UseAAV and Cre/LoxTagsmRUBY3MutationAddition of signaling peptide (POMC) on the N-ter…PromoterhSynapsinAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP20010 - pAAV-AiE2356m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230554PurposeAiE2356m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-fDIO-mCherry-IRES-WGA-Cre
Plasmid#232905PurposeFlp-dependent anterograde transsynaptic tracerDepositorInsertSyn-fDIO-mCherry-IRES-WGA-Cre
UseAAVExpressionMammalianAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#50942PurposeBicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVPromoterhSyn1Available SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
AiP1653 - pAAV-AiE2333m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214506PurposeAiE2333m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1977 - pAAV-AiE2586m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214601PurposeAiE2586m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only