We narrowed to 4,576 results for: Erf
-
Plasmid#227828PurposeTo amplify the virus that expresses C-MYC GAC F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertGAC isoform of F7 (GLS Human)
UseLentiviralTagsMYCExpressionMammalianMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GAC F7
Plasmid#227829PurposeTo express in E. coli GAC F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertGAC isoform of F7 (GLS Human)
TagsGSTExpressionBacterialMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHM1 KGA-33A
Plasmid#227836PurposeUsed for microinjection of nematodes for expression of KGA-33A, GLS with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform (GLS Human)
TagsGFPExpressionWormMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX KGA F7
Plasmid#227822PurposeTo express in E. coli KGA F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform of F7 (GLS Human)
TagsGSTExpressionBacterialMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-MYC KGA F7
Plasmid#227821PurposeTo amplify the virus that expresses C-MYC KGA F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform of F7 (GLS Human)
UseLentiviralTagsMYCExpressionMammalianMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K206R-VA
Plasmid#191224PurposeLentiviral expression of human IFIT5_K206R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTags3xFlag-TEVx2-6xHis-Strep x2 tag and VA tagExpressionMammalianMutationchanged Lysine 206 to Arginine (K206R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4s-PDGFR-WPRE
Plasmid#234449PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE1 (minus strand)
Plasmid#91838PurposeLuciferase reporter for IL2RA enhancer (IGI-P0615)DepositorInsertIL2RA CaRE1 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLP-FRT-iGluSnFR4s-NGR-WPRE
Plasmid#234453PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAV; Flp/frtTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLP-FRT-iGluSnFR4f-NGR-WPRE
Plasmid#234454PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAV; Flp/frtTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR
Plasmid#118155PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the hPGK promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
T-B18
Bacterial Strain#159446PurposeE. coli BW25113 ΔfrmA, harboring plasmid Addgene plasmid # 129104, was adaptively evolved to grow efficiently on threonine and perform significant biosynthesis while employing methanol-derived carbonBacterial ResistanceAmpicillin and KanamycinAvailable SinceAug. 18, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-ATLASsnCre (AAV5)
Viral Prep#232351-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-ATLASsnCre (#232351). In addition to the viral particles, you will also receive purified pAAV-ATLASsnCre plasmid DNA. Syn-driven, ATLASsnCre expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-BACE-HA (AAV8)
Viral Prep#232353-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-DIO-BACE-HA (#232353). In addition to the viral particles, you will also receive purified pAAV-DIO-BACE-HA plasmid DNA. Syn-driven, Beta-Secretase expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-ATLASsnFlp (AAV8)
Viral Prep#232352-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-DIO-ATLASsnFlp (#232352). In addition to the viral particles, you will also receive purified pAAV-DIO-ATLASsnFlp plasmid DNA. Syn-driven, ATLASsnFlp expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-ATLASsnFlp (AAV5)
Viral Prep#232352-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-DIO-ATLASsnFlp (#232352). In addition to the viral particles, you will also receive purified pAAV-DIO-ATLASsnFlp plasmid DNA. Syn-driven, ATLASsnFlp expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-H2B-GFP (AAV Retrograde)
Viral Prep#116869-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-H2B-GFP (#116869). In addition to the viral particles, you will also receive purified pAAV-CAG-H2B-GFP plasmid DNA. CAG-driven expression of H2B-GFP. These AAV preparations are suitable purity for injection into animals.DepositorTagsGFPAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-H2B tdTomato (AAV Retrograde)
Viral Prep#116870-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-H2B tdTomato (#116870). In addition to the viral particles, you will also receive purified pAAV-CAG-H2B tdTomato plasmid DNA. CAG-driven expression of H2B-tdTomato. These AAV preparations are suitable purity for injection into animals.DepositorTagstdTomatoAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-Arch-GFP (AAV9)
Viral Prep#22222-AAV9PurposeReady-to-use AAV9 particles produced from AAV-FLEX-Arch-GFP (#22222). In addition to the viral particles, you will also receive purified AAV-FLEX-Arch-GFP plasmid DNA. CAG-driven cre-dependent Arch-GFP expression for optogenetic neural inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFP (Cre-dependent)Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only