We narrowed to 14,321 results for: cas9
-
Plasmid#163554PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-Anc689-UdgX-NG-nCas9-RBMX
UseCRISPRExpressionMammalianMutationnCas9 (D10A)NG (L111R, D1135V, G1218R, E1219F, A1…Available sinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP305-pAAV-EFS-dSaCas9-KRAB-pA
Plasmid#113681PurposeA EFS driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPH-T2A-GFP-shP53
Plasmid#102895PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPH-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT3A
Plasmid#66819PurposedCas9 fused to BFP and the human DNMT3A catalytic domainDepositorInsertdSpCas9-BFP-DNMT3A, catalytic domain of DNMT3A
TagsdSpCas9-BFP-DNMT3AExpressionMammalianAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-3xmScarlet-dCas9
Plasmid#248561PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertdCas9
UseCRISPRTags3xmScarlet and HA, 2xNLSExpressionMammalianMutationD10A, H840APromoterCMV, TetO2Available sinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMRS-XylS-dCas9
Plasmid#220196Purposemini-Tn7 dCas9 expression vector - XylS/pM promoterDepositorInsertPseudomonas aeruginosa-codon optimized Streptococcus pyogenes dCas9
UseCRISPRExpressionBacterialMutationPseudomonas aeruginosa codon optimizedPromoterXylS/pMAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6a-IVT
Plasmid#215833PurposeTemplate for in vitro transcription of CBE6a (with SpCas9)DepositorInsertCBE6a-SpCas9-2xUGI
UseIn vitro transcription templateAvailable sinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CRY2Clust-BRD4ΔN
Plasmid#200968Purposeinduction of phase-separated condensate mediated by BRD4dN-IDRDepositorInsertBRD4dN
ExpressionBacterial and MammalianAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC-J6-dCas9-10XGP41-J9
Plasmid#202005PurposeMoClo level 0 dCas9-10XGP41 coding sequence moduleDepositorInsertdCas9-10XGP41
UseSynthetic Biology; Moclo cloning vectorTagsGS linkersAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Ptet-nCas9-BE
Plasmid#195739PurposeExpress APOVEC1-nCas9(D10A)-UGI using aTC inducible system in Methanotroph or E. coliDepositorPublicationInsertTet repressor protein / APOBEC1-nCas9(D10A)-UGI
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPtet(Tetracycline inducible protein)Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-RHOA_sgRNA
Plasmid#183878PurposepX459V2.0-HypaCas9 plasmid with RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-SunTag
Plasmid#158410PurposeCRISPR-dpcoCas9 fused with SunTag recruiting VP64 activators for transcriptional activationDepositorInsertdpcoCas9-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-VP64-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-EV2.1
Plasmid#158411PurposeCRISPR-dpcoCas9 fused with EDLL activator for transcriptional activationDepositorInsertdpcoCas9-EDLL-T2A-MS2-VPR(VP64-p65-Rta)-NOS-ter
UseCRISPRExpressionPlantAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_eA3A T31A-dCas9
Plasmid#163537PurposeMammalian CG-to-GC base editingDepositorInserteA3A T31A-dCas9
UseCRISPRExpressionMammalianMutationdCas9 (D10A, H840A)eA3A T31AAvailable sinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-eCas9-sgMIB1
Plasmid#140239PurposeLentiviral vector expressing high-specificity eSpCas9(1.1) and a gRNA targeting human MIB1DepositorInsertsgRNA targeting human MIB1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-R1R2_EF1ap300dCas9VP64_T2A_MS2p65HSF1-IRESbsdpA
Plasmid#113343PurposeExpresses p300-dCas9-VP64 and MS2-p65-HSF1 fusion proteinsDepositorInsertp300core-dCas9-VP64-T2A-MS2-p65-HSF1
UsePiggybacAvailable sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only