We narrowed to 6,163 results for: cas9 expression plasmid
-
Plasmid#167861PurposePiggyBac compatible plasmid expressing spCas9DepositorInsertCas9
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_KanR neo
Plasmid#167893PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAct:dCas9-VPR
Plasmid#78898PurposeExpresses dCas9-VPR under Actin promoter for CRISPRa in Drosophila cell culture. Please note- this plasmid does not express GFP.DepositorInsertdCas9-VPR
UseCRISPRExpressionInsectPromoterpActin (Drosophila)Available SinceAug. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
All_in_one_CRISPR/Cas9_LacZ
Plasmid#74293Purpose"All-in-one" CRISPR/Cas9 (wt) plasmid for cloning of custom gRNA with blue/white screeningDepositorInsertsLacZ-alpha
Cas9
mCherry
UseCRISPRTagsHAExpressionBacterial and MammalianPromoterLac promoter, SV40, and T7 promoterAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM
Plasmid#92220PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA cloned in Bbs I sitesDepositorInsertsSp-dCas9-2xAM tag
gRNA to be inserted into Bbs I sites
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAct:dCas9-scFv
Plasmid#78900PurposeExpresses scFv-VP64 under actin promoter for SunTag CRISPRa in Drosophila cellsDepositorInsertscFV-VP64
UseCRISPRTagsGFPExpressionInsectPromoterpActin (Drosophila)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Venus (EDCPV)
Plasmid#90085PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianPromoterEFSAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry
Plasmid#64324PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP
Plasmid#64323PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-EBFP2ExpressionMammalianPromoterCBh and U6Available SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)
Plasmid#47868PurposeThis plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter.DepositorInsertsNmCas9
U6pr-tracrRNA
UseCRISPRTagsHA and NLSExpressionMammalianPromoterEF1a and U6Available SinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hNme2Cas9-NLS(SV40)-3xFLAG (KAC582)
Plasmid#134331PurposeCAG promoter expression plasmid for human codon optimized Nme2Cas9 nuclease with C-terminal NLS (SV40) and 3x FLAG tagDepositorInserthuman codon optimized Nme2Cas9
TagsNLS(SV40)-3xFLAGExpressionMammalianPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN701: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS
Plasmid#121828PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IF405: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-p300core
Plasmid#121825PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/p300core (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LF901: pMAGIC (L1-R5) mU6::SaCas9 gRNA scaffold
Plasmid#121811PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only