We narrowed to 953 results for: dcas9, grna
-
Plasmid#192682PurposeLentiviral expression of multi gRNAs targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNAs #1,2,3 (ASCL1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Multiplex CRISPR dCas9/FokI-dCas9 Accessory Pack
Plasmid Kit#1000000062PurposeAccessory pack for construction of all-in-one CRISPR/Cas9 vectors expressing multiple gRNAs with either dCas9 or dCas9-FokI fusion; Kit #1000000055 is required to use this kitDepositorAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LF901: pMAGIC (L1-R5) mU6::SaCas9 gRNA scaffold
Plasmid#121811PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LF701: pMAGIC (L1-R5) hU6::xCas9(3.7) gRNA scaffold
Plasmid#121817PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LG002: pMAGIC (L1-R5) mU6::xCas9(3.7) gRNA scaffold
Plasmid#121816PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JI601: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; RIP
Plasmid#121815PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and RIP for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JI702: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; RIP
Plasmid#121820PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and RIP for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ801: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121814PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KB501: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121813PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
KB601: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121819PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KB701: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121818PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti sgRNA(MS2) mCherry
Plasmid#171053PurposeExpression of Vp64-dCas9 activation systemDepositorInsertsgRNA(MS2) mCherry
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-8x-gRNA-eGFP
Plasmid#60718PurposeeGFP reporter containing 8 copies of a gRNA binding site for light-inducible dCas9 activationDepositorInsert8 copies of gRNA binding site (5'-AAAGGTCGAGAAACTGCAAA-3')
UseTagsExpressionMutationPromoterAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti pTERT sgRNA1(MS2) mCherry
Plasmid#171054PurposeTargeting of Vp64-dCas9 activation system to hTERT promoterDepositorInsertpTERT sgRNA1(MS2) mCherry
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti pTERT sgRNA2(MS2) mCherry
Plasmid#171055PurposeTargeting of Vp64-dCas9 activation system to hTERT promoterDepositorInsertpTERT sgRNA2(MS2) mCherry
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRP_8xgRNA-FLuc
Plasmid#135937PurposeFirefly luciferase reporter containing 8 copies of a gRNA binding site for light-inducible dCas9 activation.DepositorInsert8 copies of gRNA binding site (5'-AAAGGTCGAGAAACTGCAAA-3')
UseLuciferaseTagsExpressionMammalianMutationPromoterminCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only