We narrowed to 14,418 results for: cas9
-
Plasmid#222864PurposeThis plasmid codes for the guide of the OgeuIscB with a GCA targetDepositorInsertOgeuIscB omega RNA with a (GCA)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB TGC RNA
Plasmid#222863PurposeThis plasmid codes for the guide of the OgeuIscB with a TGC targetDepositorInsertOgeuIscB omega RNA with a (TGC)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB AGC RNA
Plasmid#222866PurposeThis plasmid codes for the guide of the OgeuIscB with a AGC targetDepositorInsertOgeuIscB omega RNA with a (AGC)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB CAG RNA
Plasmid#222867PurposeThis plasmid codes for the guide of the OgeuIscB with a CAG targetDepositorInsertOgeuIscB omega RNA with a (CAG)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPN10
Plasmid#114386PurposeEmpty gRNADepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKozak_Gal4vp16_synCoTC_4xnrUAS-mTagBFP2
Plasmid#199496PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertGal4vp16/4xnrUAS-mTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
LC-E75
Bacterial Strain#115925PurposeExpression of dCas9 gene under the control of a weak Ptet promoter in the E. coli chromosomeDepositorBacterial ResistanceNoneAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHSE401
Plasmid#62201PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti dCAS-VP64_Blast
Plasmid#61425Purpose3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE)DepositorHas ServiceLentiviral PrepInsertdCAS9(D10A, N863A)-VP64_2A_Blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1AAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cloning template vector
Plasmid#131471PurposeCloning template form ORANGE method based knock-in constructsDepositorTypeEmpty backboneTagsHAExpressionMammalianPromoterU6 and CbhAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKSE401
Plasmid#62202PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Kan resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
HF-PX459 (V2)
Plasmid#118632PurposePlasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistanceDepositorInserthSpCas9-HF1-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationAsparagine 497 to Alanine, Arginine 661 to Alanin…PromoterCbhAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166
Plasmid#109328PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zCas9-NLS without promoterDepositorInsertzCas9
UseCRISPR; Gateway compatible zcas9 entry cloneTags3x FLAG, NLS and NLSExpressionPlantMutationZea mays codon-optimized Cas9Available SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX458-ECFP
Plasmid#112220PurposeCloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and ECFPDepositorInsertECFP
UseCRISPRExpressionMammalianAvailable SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB9v1
Plasmid#210028PurposeContains Cas9 gRNA cloning site, inducible Cas9, rtTA-T2A-puroDepositorInsertsCas9
rtta-T2A-puro
UseCRISPRTagsSV40 NLS and nucleoplasmin NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.tRFP
Plasmid#57826PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-tRFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -