We narrowed to 4,885 results for: POR C
-
Plasmid#124257PurposeExpresses IDH1 with a R132H mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertIsocitrate dehydrogenase 1 (R132H) (IDH1 Human)
ExpressionMammalianMutationArginine 132 is mutated to Histidine. This mutati…Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(PAMmut)
Plasmid#176139PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resistance cassetteDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianPromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
3NES-CS(G)-tTA-CS(G)-3NES
Plasmid#137836PurposeSoluble tTA transcription factor flanked by N and C terminal TEV protease G cleavage sequences and 3 nuclear export sequencesDepositorInsert3NES-CD(G)-tTA-CS(G)-3NES
ExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLP_mod_mNeonGreen11_P2A_puroR_CRE-GFP
Plasmid#229227PurposeModular BxB1 landing pad vector containing C-term mNeonGreen11 tag, puroR marker, and a cAMP GFP reporter.DepositorTypeEmpty backboneTagsmNeonGreen11ExpressionMammalianAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMTS-hFluc-HA-GFP11
Plasmid#177726PurposeFirefly luciferase reporter fused to a mitochondria signal sequence for mitochondrial targeting with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, and Mitochondrial Targeting SequenceExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cyto-ExRai-CKAR2
Plasmid#236097PurposeCytosol-targeted enhanced excitation-ratiometric biosensor for monitoring Protein Kinase C activity in living cells.DepositorInsertExRai-CKAR2-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceMay 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKESaPar
Plasmid#211829PurposeLow copy number protein expression plasmid, suitable for electroporation in C. necator. Containes eGFP as model protein and a RP4 partitioning system to increase segregational stability.DepositorInserteGFP
ExpressionBacterialPromoterT5Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-WT-eGFP-KDEL
Plasmid#177727PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention and fused to eGFP at the C-terminusDepositorInserthFluc
TagsKDEL, Prolactin Signal Sequence, and eGFPExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_Sec61B-V5-APEX2
Plasmid#83411PurposeExpressed C-term tagged APEX2 on Sec61B in mammalian cellDepositorInsertSec61B-V5-APEX2 (SEC61B Human, Synthetic)
TagsAPEX2 and V5ExpressionMammalianPromoterCMV-FAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-Aqp4-BioID2-BioID2-HA
Plasmid#176742PurposeExpresses Aquaporin-4 fused with BioID2 at the C-terminus in astrocytesDepositorInsertAqp4-BioID2-BioID2-HA
UseAAVTagsHAExpressionBacterialPromotergfaABC1DAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMyc4ElbLuc.
Plasmid#53246Purposereporter plasmid containing 4 myc cDNA binding sitesDepositorInsertpMyc4ElbLuc (MYC Human)
MutationTo prepare plasmids with one, two, three, and fou…Available SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-PQRv3-RFP
Plasmid#73951PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.DepositorInsertssfGFP (superfolder GFP)
RFP
TagsA residual PQR peptide wii be left at the C-termi…ExpressionMammalianPromoterChicken beta actin and Chicken beta actin (shared…Available SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMyc3ElbLuc
Plasmid#53245Purposereporter plasmid containing 3 myc cDNA binding sitesDepositorInsertpMyc3ElbLuc (MYC Human)
MutationTo prepare plasmids with one, two, three, and fou…Available SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMyc1ElbLuc,
Plasmid#53243Purposereporter plasmid containing 1 myc cDNA binding sitesDepositorInsertpMyc1ElbLuc (MYC Human)
MutationTo prepare plasmids with one, two, three, and fou…Available SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-DM-eGFP-KDEL
Plasmid#177728PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention and fused to eGFP at the C-terminusDepositorInserthFlucDM
TagsKDEL, Prolactin Signal Sequence, and eGFPExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMyc2ElbLuc,
Plasmid#53244Purposereporter plasmid containing 2 myc cDNA binding sitesDepositorInsertpMyc2ElbLuc (MYC Human)
MutationTo prepare plasmids with one, two, three, and fou…Available SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCHC022 (∆phcA)
Plasmid#226200PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator LysR-type transcriptional regulator PhcA.DepositorInsertHomology arms for PhcA
UseSynthetic BiologyAvailable SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCHC004 (∆phaCAB)
Plasmid#226198PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator phaCAB operon, to prevent accumulation of PHB.DepositorInsertHomology arms for phaCAB
UseSynthetic BiologyAvailable SinceNov. 15, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX459-HypaCas9-mR2-H2BC11_sgRNA
Plasmid#183881PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only