We narrowed to 19,744 results for: Comp;
-
Plasmid#87165Purposefluorescence complementation assayDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only
-
ST-SBP-EGFP_puromycin
Plasmid#65270PurposeST reporter only ( no hook) (RUSH system)DepositorInserttruncated sialyltransferase (ST6GAL1 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianMutationcontains only amino acids 1 to 43 of STPromoterCMVAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP1a_G
Plasmid#146400PurposeMammalian Expression of HsDcp1aDepositorInsertHsDcp1a (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-HsNot4-GB1His6_AG
Plasmid#148792PurposeBacterial Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
ExpressionBacterialMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
Plasmid#210504Purposeexpresses NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry component in mammalian cellsDepositorInsertNES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
ExpressionMammalianAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
TagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PatoM-LOG241
Plasmid#72847PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. LOG241 backbone.DepositorInsertPatoM
ExpressionBacterialPromoterPatoMAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
His-MBP-NRBF2 (1-159)
Plasmid#99331PurposeMammalian expression of the monomeric form of NRBF2 that binds with the PI3K C1 complexDepositorInsertNuclear receptor-binding factor 2 (NRBF2 Human)
Tags6xHis-MBP-TEVExpressionBacterialMutationAA1-159 are presentPromoterT7Available SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only