We narrowed to 1,613 results for: aav vector plasmid
-
Plasmid#127091PurposeAn AAV genome with Cre-dependent expression of tTA from the CAG promoterDepositorInserttTA
UseAAVExpressionMammalianMutation*(see below)PromoterCAGAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-CasRx-pa
Plasmid#233035PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV TBG FFluc miR122sponge
Plasmid#35657DepositorInsertmiR-122 sponge
UseAAVPromoterTBGAvailable SinceJuly 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc CB6PI Gpluc7XmiR-122T
Plasmid#35647DepositorInsert7 bulged miR-122 target sites
UseAAVPromoterCBAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-Ple155-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231351PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from Ple155 element, active in Purkinje cells.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231355PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CAG-EGFP-W3SL-BC(p1-10)
Plasmid#231347PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-flex-lck-smV5
Plasmid#196423PurposeCre-dependent AAV expression of membrane-targeted V5 spaghetti monster reporter; no cell-type specificityDepositorInsertLck-smV5
UseAAV and Cre/LoxTagsLckExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE-U2AF2-TurboID-HA-rtTA
Plasmid#226997PurposeIntegrative plasmid to express U2AF2-TurboID in mammalian cellsDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-T2A-mCherry-pA
Plasmid#192499PurposeTo express DjCas13dDepositorInsertDjCas13d
UseAAVMutationNoPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-EGFP
Plasmid#176274PurposeViral vector for expression of EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertEGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-FlpOn-CreOff-TdTomato
Plasmid#176275PurposeViral vector for expression of TdTomato in cells expressing Flp AND NOT Cre driven by the human Synapsin promoter.DepositorInserttdTomato
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-T2A-mCherry-pA
Plasmid#192494PurposeTo express CasRxDepositorInsertCasRx
UseAAVMutationNoPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-0.4CaMKII-CasRx-T2A-mCherry-pA
Plasmid#192483PurposeTo express CasRxDepositorInsertCasRx
UseAAVMutationNoPromoter0.4CaMKIIaAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CasRx-T2A-mCherry-pA
Plasmid#192484PurposeTo express CasRxDepositorInsertCasRx
UseAAVMutationNoPromoterEf1aAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV_pSyn_Mito-LOV-Turbo-V5
Plasmid#199669Purposeexpresses Mito-LOV-Turbo-V5 in neurons, AAV vectorDepositorInsertLOV-Turbo
UseAAVTagsCOX4I1 mito targeting sequence and V5PromoterSynapsinAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ABE-NT-sgRNA
Plasmid#112734PurposeAAV inverted terminal repeat based vector plasmid encoding E. coli TadA, the N-terminal half of nCas9 and sgRNADepositorInsertABE-NT-sgRNA
UseAAVAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only