We narrowed to 34,114 results for: IND
-
Plasmid#120548PurposeExpress 3xNLS-Sox2 TALE-GCN4 engineered to bind a site in the human SOX2 geneDepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only
-
EF1a-3NLS-NGN2TALE-GCN4
Plasmid#120547PurposeExpress 3xNLS-NGN2 TALE-GCN4 engineered to bind a site in the human NGN2 eneDepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVL43 - pNST3>>
Plasmid#116009Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpNST3:GR-LhG4:tNST3:F-H adapter-H-A adapter::pOp4:SP(ER)-mTurquoise2-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVL42 - pLTP1>>
Plasmid#116008Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpLTP1:GR-LhG4:tLT1:F-H adapter-H-A adapter::pOp4:SP(ER)-mTurquoise2-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-puro-eGFP-HEC1-M4
Plasmid#114036PurposeExpression of HEC1 M4 mutant tagged with GFPDepositorInsertGFP tagged - HEC1 -M4 (NDC80 Human)
ExpressionMammalianMutationM4 (K146E, R153E, K156E)PromoterCMV TetOAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-puro-eGFP-HEC1-M2
Plasmid#114035PurposeExpression of HEC1 M2 mutant tagged with GFPDepositorInsertGFP tagged - HEC1 -M2 (NDC80 Human)
ExpressionMammalianMutationM2 (K81E, N87E, K89E)PromoterCMV TetOAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47A)
Plasmid#112722PurposeArg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R47A)
Tags6His-TEVExpressionBacterialMutationR47APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q48A)
Plasmid#112724PurposeGln48 contacts the backbone of TAR RNA as well as mediates intramoecular interaction to stabilize the conformation of beta2-beta3 loop within TBP6.7.DepositorInsert6His-TEV-TBP6.7(Q48A)
Tags6His-TEVExpressionBacterialMutationQ48APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R52A)
Plasmid#112729Purpose52nd position is Arg in both wild-type U1A and TBPs, but the RNA recognition by this residue in both types of proteins is fundamentally different.DepositorInsert6His-TEV-TBP6.7(R52A)
Tags6His-TEVExpressionBacterialMutationR52APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(delta C-term)
Plasmid#112731PurposeThis mutant of TBP6.7 is lacking residues 91-98 at C-terminus, and was used to test the involvement of those residues in TAR recognition.DepositorInsert6His-TEV-TBP6.7(delta C-term)
Tags6His-TEVExpressionBacterialMutationdelta C-termPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_LKB1_CR
Plasmid#108112PurposeLentiviral expression plasmid of human LKB1 cDNA (CRISPR-resistant silent mutation) with neomycin resistance geneDepositorInsertLKB1 (STK11 Human)
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationchange cytosine 333 to alanine (silent mutation)PromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PatoM-OG241
Plasmid#72842PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. OG241 backbone.DepositorInsertPatoM
ExpressionBacterialPromoterPatoMAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETDUET1-hUCH37 (ISF1) - hNFRKB (1-156) GSGS
Plasmid#61940PurposeCo-expression of hUCH37 (ISF1) and hNFRKB (1-156) GSGS in E.coliDepositorTags6x HISExpressionBacterialMutationConstruct ends at residue 156, residues 97-100 (N…PromoterT7Available SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETDUET1-hUCH37 (ISF1) - hNFRKB (1-117)
Plasmid#61941PurposeCo-expression of hUCH37 (ISF1) and hNFRKB (1-117) in E.coliDepositorTags6x HISExpressionBacterialMutationConstruct ends at residue 117, stop codon introdu…PromoterT7Available SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
GalT-RpHLuorin2
Plasmid#171719PurposeTrans-Golgi expression of ratiometric pHLuorin2DepositorInsertRatiometric pHLuorin2 fused to B4GALT1 (B4GALT1 Human)
Tagsratiometric pHluorin2ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7
Plasmid#136466PurposeMammalian expression of non-targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
ExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF1alpha P402A/P564A-pcDNA3
Plasmid#18955DepositorInsertHypoxia inducible factor 1 alpha (HIF1A Human)
TagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 402 to Alanin…Available SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2alpha-P405A/P531A-pcDNA3
Plasmid#18956DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
TagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
MGAT2-RpHLuorin2
Plasmid#171718PurposeCis-/medial-Golgi expression of ratiometric pHLuorin2DepositorInsertRatiometric pHLuorin2 fused to MGAT2 (MGAT2 Human)
Tagsratiometric pHluorin2ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only