We narrowed to 18,985 results for: Ung;
-
-
-
-
-
-
-
pIN3 (gpdA-cTerm-Citrine2-ptrA)
Plasmid#188737PurposeExpresses Citrine2 for C-terminal taggingDepositorInsertgdpA-Citrine2 PtrA
UseFilamentous fungal expressionTagsCitrine2Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN4 (gpdA-nTerm-Citrine2-ptrA)
Plasmid#188738PurposeExpresses Citrine2 for N-terminal taggingDepositorInsertgdpA-Citrine2 PtrA
UseFilamentous fungal expressionTagsCitrine2Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN5 (gpdA-cTerm-mTurqoise2-ptrA)
Plasmid#188739PurposeExpresses mTurqoise2 for C-terminal taggingDepositorInsertgdpA-mTurquoise PtrA
UseFilamentous fungal expressionTagsmTurquoiseAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN6 (gpdA-nTerm-mTurqoise2-ptrA)
Plasmid#188740PurposeExpresses mTurqoise2 for N-terminal taggingDepositorInsertgdpA-mTurqoise2 PtrA
UseFilamentous fungal expressionTagsmGreenlanternAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
XLone-BSD NFIL3
Plasmid#179512PurposeTunable and temporal expression control of NFIL3DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
BPK880-pCAG-DmrC-NLS-3xFLAG-VP64
Plasmid#136912PurposeDmrC with VP64 fused to it's C-terminus; Mammalian expression vectorDepositorInsertpCAG-DmrC-NLS-3xFLAG-VP64
UseCRISPRExpressionMammalianPromoterChicken Beta ActinAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-His-MS2BP-G3BP1-S149A
Plasmid#136009PurposeS149A G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Unstructured
Plasmid#136026PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only