We narrowed to 12,161 results for: 110
-
Plasmid#110595PurposeBTK Type 6 Repressor CDS for golden gate assemblyDepositorInsertLacI reverse
UseSynthetic BiologyAvailable SinceFeb. 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMXs_FLAG-FSF1
Plasmid#110641PurposeRetroviral expression of flag-tagged yeast FSF1 in mammalian cellsDepositorInsertFSF1 (FSF1 Budding Yeast)
UseRetroviralTagsFLAGExpressionMammalianMutationcodon-optimized cDNA (no amino acid mutations)Available SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
WNK3 (WNK3B-c016)
Plasmid#110252PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-Y117C
Plasmid#110216PurposeExpression in mammalian cells of of full-length SPRTN protein carrying Y117C mutation, a catalytically-impaired mutant, and Flag-tag at N-terminus.DepositorInsertSPRTN (SPRTN Human)
TagsFlagExpressionMammalianMutationY117C, P296L (see depositor comments below)Available SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
Calprotectin S100A9 toehold switch sensor
Plasmid#110717PurposeToehold switch sensor to detect Calprotectin S100A9 mRNA with GFP outputDepositorInsertCalprotectin S100A9 toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
C. difficile toxin B mRNA toehold switch sensor
Plasmid#110715PurposeToehold switch sensor to detect the tcdB mRNA from toxigenic C. difficile with GFP outputDepositorInsertC. difficile toxin B toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE hygro MEN1 T344R
Plasmid#11019DepositorAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-CD5Flag2-P2A-smAID-mClover
Plasmid#110657PurposeLentiviral vector expressing cell surface Flag-tag and monomeric GFP N-terminaly fused with auxin inducible degronDepositorInsertCD5Flag2-P2A-AID-mClover
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HRPT2 L64P
Plasmid#11052DepositorAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pET28a-P5CR
Plasmid#110295PurposeExpresses pyrroline-5-carboxylate reductase in E. coli BL21(DE3)DepositorInsertPyrroline-5-carboxylate Reductase
TagsHis6ExpressionBacterialPromoterT7Available SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKOdeltagalK (Apr)
Plasmid#110091PurposeAnalogous to pKO but without the negative selection gene galK.DepositorTypeEmpty backboneUseBacterial knockout generationAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKOdeltasacB (Kan)
Plasmid#110092PurposeAnalogous to pKO but without the negative selection gene sacB.DepositorTypeEmpty backboneUseBacterial knockout generationAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW8_6XFLAG
Plasmid#110235PurposeCre/Lox C-terminal tagging construct encoding 6 copies of the FLAG epitopeDepositorTypeEmpty backboneUseCre/LoxAvailable SinceApril 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_GNAO1_G-alpha
Plasmid#110013PurposeProtein expression and purification of GNAO1_G-alphaDepositorInsertGNAO1_G-alpha (GNAO1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
plko-tet-on-puromycin-shTRX1-259
Plasmid#110920PurposeTo knockdown Thioredoxin-1 following doxycycline additionDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE.puro/TO/Flag/tGFP.HuR.S221D
Plasmid#110351PurposeDoxycycline inducible mammalian retroviral expression of HuR (S221D) with FLAG and turboGFP tagsDepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsFLAG and tGFPExpressionMammalianMutationS221D, P237SPromotergagAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_HLA-DRB1_MHC-II-beta
Plasmid#110021PurposeProtein expression and purification of HLA-DRB1_MHC-II-betaDepositorInsertHLA-DRB1_MHC-II-beta (HLA-DRB1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-PLEKHS1
Plasmid#110509PurposeFluorescent PLEKHS1DepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HRPT2 227X
Plasmid#11050DepositorInsertHRPT2 227X (CDC73 Human)
TagsflagExpressionMammalianMutationtruncation mutant with a stop codon introduced at…Available SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only