We narrowed to 4,340 results for: 110
-
Plasmid#110621PurposeBTK assembled broad-host-range plasmid encoding GFP driven by CP6 promoterDepositorInsertGFP
ExpressionBacterialAvailable sinceSept. 21, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
B. fragilis mRNA toehold switch sensor
Plasmid#110706PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertB. fragilis species specific toehold switch sensor
UseSynthetic BiologyPromoterT7Available sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. fragilis 16S toehold switch sensor
Plasmid#110696PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. fragilis 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28b-PaODH
Plasmid#110802PurposeExpresses PaODH and opine dehydrogenase from Pseudomonas aeruginosaDepositorInsertPa4835
TagsHexahistidine tagExpressionBacterialPromoterT7Available sinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET15TV-L-SaNAS
Plasmid#110803PurposeExpresses SaNAS a nicotianamine synthase from Staphylcoccus aureusDepositorAvailable sinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBTK550d
Plasmid#110617PurposeBTK assembled broad-host-range plasmid encoding inducible GFP driven by T7 polymeraseDepositorInsertGFP
ExpressionBacterialAvailable sinceAug. 10, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET28b-PaNAS
Plasmid#110801PurposeExpresses PaNAS nicotianamine synthase from pseudomonas aeruginosaDepositorInsertPa4836
TagsHexahistidine tagExpressionBacterialPromoterT7Available sinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET15TV-L-SaODH
Plasmid#110804PurposeExpresses SaODH and opine dehydrogenase from Staphylococcus aureusDepositorAvailable sinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
T1-araC-Pbad-D10A/H840A cas9 ABCD-pACYC-BB
Plasmid#110547PurposeCRISPR interference; works in conjunction with an sgRNA expression vector to silence genes in the E. coli chromosome.DepositorInsertdCas9
ExpressionBacterialMutationD10A, H840APromoterpBADAvailable sinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-PKCZdel239
Plasmid#110513PurposeConstitutive ActiveDepositorInsertPKCZ (PRKCZ Human)
TagsEGFPExpressionMammalianMutationDeleted amino terminal 239 amino acidsAvailable sinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
IQSEC2 (IQSEC2A-c001)
Plasmid#110259PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-PGK-Puro
Plasmid#110858PurposeLentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-GFP-PGK-Puro
Plasmid#110864PurposeLentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRP(Exp)-CMV> ORF_924bp (Azgp1):dTomato:IRES:Puro
Plasmid#110831PurposeExpresses both zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter, where the fluorescent dT reporter is fused with the ZAG protein.DepositorAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
BSP188
Plasmid#110917PurposeFor cloning by HR in yeast, Universal MosSCI compatible, has unc54 terminator clonedDepositorInsertunc54 Terminator
UseSynthetic Biology; Yeast homologous recombination…ExpressionWormAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQC V5 MCS IRES G418
Plasmid#110345Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. V5 N-Terminal tag, IRES-driven Geneticin selection.DepositorTypeEmpty backboneUseRetroviralExpressionMammalianPromoterCMVAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQC MCS IRES G418
Plasmid#110344Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Geneticin selection.DepositorTypeEmpty backboneUseRetroviralExpressionMammalianPromoterCMVAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
plko-tet-on-puromycin-shTRX1-259
Plasmid#110920PurposeTo knockdown Thioredoxin-1 following doxycycline additionDepositorAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
proISG15 C-term. domain (79-165)
Plasmid#110763PurposeBacterial expression of proISG15 C-term. domainDepositorAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only