We narrowed to 549 results for: CAG synthetic promoter
-
Plasmid#248694PurposesgRNA expression vector - pBG35 promoter with Tn7sg negative control sgRNADepositorInsertTn7sg
ExpressionBacterialPromoterBG35Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS2050
Plasmid#49135PurposeAAV plasmid with CAGGS promoter driving expression of EmGFP.DepositorInsertssAAV-CAGGS-emGFP
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1988
Plasmid#49119PurposeAAV plasmid with CAGGS promoter driving expression of iCre.DepositorInsertssAAV-CAGGS-iCre
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1989
Plasmid#49120PurposeAAV plasmid with CAGGS promoter driving expression of iCre. Contains WPRE.DepositorInsertssAAV-CAGGS-iCre-WPRE
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS2058
Plasmid#49136PurposeAAV plasmid with CAGGS promoter driving expression of EmGFP. Contains WPRE.DepositorInsertssAAV-CAGGS-emGFP-WPRE
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiCRISPR - DDX3Y sgRNA 1
Plasmid#70656PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-epegRNA
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
msEGFP-PACR_pRSETB
Plasmid#55775PurposeGenetically encoded caged Ca2+DepositorInsertPACR
Tags6xHis and msEGFPExpressionBacterialPromoterT7 promoterAvailable SinceJuly 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-miRFP703-dSal-VP16minADx3-hCRY2-NLS
Plasmid#241843PurposeExpresses an actuator of Opto-p53 in mammalian cells.DepositorInsertVP16
TagsCRY2 and miRFP703ExpressionMammalianMutationVP16 minimal activation domain x 3PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-Nluc
Plasmid#192657PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-NlucDepositorInsertNluc
UseLuciferaseExpressionMammalianPromoterU6, miniCMVAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Blasticidin XLone-eGFP
Plasmid#159754PurposeAAVS1 donor plasmid for targeted inducible eGFP expression in human cellsDepositorInsertall-in-one tet-on system
UseCRISPR and TALEN; Donor plasmid for targeted knocā¦ExpressionMammalianPromoterTRE3GS inducible promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLRK57
Plasmid#253106PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting DWF4 genes in wheatDepositorInsertSpCas9-P2A-RUBY
UseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbi1Available SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-Fgf5Pro
Plasmid#227481Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only