We narrowed to 17,864 results for: Emb
-
Plasmid#169168PurposeConjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.DepositorInsertMAP1LC3B (MAP1LC3B Human)
Tags6X Histidine Tag, TEV cleavage site, mCherryExpressionBacterialPromoterT7 lac promoterAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAraGFP
Plasmid#39548DepositorInserteGFP
ExpressionBacterialAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAraTM
Plasmid#39547DepositorTypeEmpty backboneExpressionBacterialPromoterTacAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET21a AHU
Plasmid#26640DepositorInsertAHU
ExpressionBacterialAvailable SinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAraTM-2BTMCYwt
Plasmid#39549DepositorInsertIntegrin alpha2B TM-CYTO
ExpressionBacterialPromoterTacAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAraTM-2BTMCYL980A
Plasmid#39550DepositorInsertIntegrin alpha2B L980A TM-CYTO
ExpressionBacterialPromoterTacAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pOmpF
Plasmid#42606DepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceFeb. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBSII-MEME-mTagBFP(AM)
Plasmid#244810PurposeIn-Vitro Synthesis of mRNA encoding a Honeybee-optimized mTagBFP2-labeled GAP43 Membrane Anchor (MEME) TagDepositorInsertmTagBFP2
UseIn-vitro mrna synthesisTagsGAP43 Membrane Anchor (MEME) TagMutationcoding sequence is optimized for the HoneybeePromoterT7Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSII-MEME-mEmerald(AM)
Plasmid#244813PurposeIn-Vitro Synthesis of mRNA encoding a Honeybee-optimized mEmerald-labeled GAP43 Membrane Anchor (MEME) TagDepositorInsertmEmerald
UseIn-vitro mrna synthesisTagsGAP43 Membrane Anchor (MEME) TagMutationcoding sequence is optimized for the HoneybeePromoterT7Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSII-MEME-mCherry(AM)
Plasmid#244816PurposeIn-Vitro Synthesis of mRNA encoding a Honeybee-optimized mCherry-labeled GAP43 Membrane Anchor (MEME) TagDepositorInsertmCherry
UseIn-vitro mrna synthesisTagsGAP43 Membrane Anchor (MEME) TagMutationcoding sequence is optimized for the HoneybeePromoterT7Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAraGFPCDF
Plasmid#47516PurposeContains PBAD::GFP reporter, used for heterodimer competition assayDepositorInsertGFP
ExpressionBacterialAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLCAG EGFP
Plasmid#14857DepositorInsertEGFP
UseLentiviralExpressionMammalianAvailable SinceMay 11, 2007AvailabilityAcademic Institutions and Nonprofits only -
pYTK096
Plasmid#65203PurposePre-Assembled Ura3 integration vector to be used in the Dueber YTK system.DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
NH-11
Plasmid#87516PurposeFor library amplification of fragment NH-11DepositorInsertNH-11
UseSynthetic Biology and TALEN; Tale dbd library pre…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
NH-12
Plasmid#87517PurposeFor library amplification of fragment NH-12DepositorInsertNH-12
UseSynthetic Biology and TALEN; Tale dbd library pre…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
NH-13
Plasmid#87518PurposeFor library amplification of fragment NH-13DepositorInsertNH-13
UseSynthetic Biology and TALEN; Tale dbd library pre…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
NH-14
Plasmid#87519PurposeFor library amplification of fragment NH-14DepositorInsertNH-14
UseSynthetic Biology and TALEN; Tale dbd library pre…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only