Skip to main content

We narrowed to 30,755 results for: Ide

Showing: 481 - 500 of 30755 results
  1. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide1

    Plasmid
    #118169
    Purpose
    CRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    April 3, 2019
    Availability
    Academic Institutions and Nonprofits only
  2. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide2

    Plasmid
    #118170
    Purpose
    CRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    April 1, 2019
    Availability
    Academic Institutions and Nonprofits only
  3. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide3

    Plasmid
    #118171
    Purpose
    CRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    April 2, 2019
    Availability
    Academic Institutions and Nonprofits only
  4. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR GLIS3 TSS-guide3

    Plasmid
    #118175
    Purpose
    CRISPR-mediated repression of GLIS3. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    April 2, 2019
    Availability
    Academic Institutions and Nonprofits only
  5. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CRY2-TSS-guide1

    Plasmid
    #125428
    Purpose
    CRISPR-mediated repression of CRY2. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    July 25, 2019
    Availability
    Academic Institutions and Nonprofits only
  6. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CRY2-TSS-guide2

    Plasmid
    #125429
    Purpose
    CRISPR-mediated repression of CRY2. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    July 24, 2019
    Availability
    Academic Institutions and Nonprofits only
  7. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR C2CD4B-TSS-guide2

    Plasmid
    #125421
    Purpose
    CRISPR-mediated repression of C2CD4B. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    July 24, 2019
    Availability
    Academic Institutions and Nonprofits only
  8. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR C2CD4A-TSS-guide4

    Plasmid
    #125419
    Purpose
    CRISPR-mediated repression of C2CD4A. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    July 24, 2019
    Availability
    Academic Institutions and Nonprofits only
  9. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR VPS13C-TSS-guide3

    Plasmid
    #125414
    Purpose
    CRISPR-mediated repression of VPS13C. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    July 24, 2019
    Availability
    Academic Institutions and Nonprofits only
  10. pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)

    Plasmid
    #202555
    Purpose
    Synaptotagmin-1 sgRNA2 with TagBFP2
    Depositor
    Insert
    CRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
    Use
    CRISPR and Lentiviral
    Tags
    3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2
    Available Since
    Dec. 12, 2024
    Availability
    Academic Institutions and Nonprofits only
  11. pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)

    Plasmid
    #202556
    Purpose
    Synaptotagmin-1 sgRNA3 with TagBFP2
    Depositor
    Insert
    CRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
    Use
    CRISPR and Lentiviral
    Tags
    3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2
    Available Since
    Dec. 12, 2024
    Availability
    Academic Institutions and Nonprofits only
  12. pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)

    Plasmid
    #202554
    Purpose
    Synaptotagmin-1 sgRNA1 with TagBFP2
    Depositor
    Insert
    CRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
    Use
    CRISPR and Lentiviral
    Tags
    3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2
    Available Since
    Dec. 12, 2024
    Availability
    Academic Institutions and Nonprofits only
  13. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZBED3-TSS-guide4

    Plasmid
    #125451
    Purpose
    CRISPR-mediated repression of ZBED3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    July 25, 2019
    Availability
    Academic Institutions and Nonprofits only
  14. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZBED3-TSS-guide3

    Plasmid
    #125450
    Purpose
    CRISPR-mediated repression of ZBED3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    July 25, 2019
    Availability
    Academic Institutions and Nonprofits only
  15. Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZBED3-TSS-guide2

    Plasmid
    #125449
    Purpose
    CRISPR-mediated repression of ZBED3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.
    Depositor
    Insert
    KRAB-dCas9-2A-BlastR
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Expression
    Mammalian
    Promoter
    hPGK and U6
    Available Since
    July 25, 2019
    Availability
    Academic Institutions and Nonprofits only
Showing: 481 - 500 of 30755 results