We narrowed to 8,868 results for: chloramphenicol
-
Plasmid#246715PurposeEntry plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertBasal stem of Arabidopsis MIR390a precursor with A18G mutation and a chloramphenicol-ccdB cassette flanked by 2 BsaI sites (MIR390a Mustard Weed)
UseGateway CloningAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-A18G-B/c
Plasmid#246716PurposeCloning amiRNA sequences in AtMIR390a-A18G precursors for in planta expressionDepositorInsertBasal stem of Arabidopsis MIR390a precursor with A18G mutation & chloramphenicol-ccdB cassette flanked by two BsaI sites (MIR390a Mustard Weed)
UseRNAiExpressionPlantAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDCAF3-IS5
Plasmid#65220PurposeExpresses N-demethylases for the degredation of caffeine and related methylxanthines. Can be used to measure caffeine content as described in the publication listed below.DepositorInsertsndmA
ndmB
ndmC
ndmD
gst9
chlR
UseSynthetic BiologyExpressionBacterialMutationChanged start codon from gtg to atg and Changed s…PromoterBBa_J23100Available SinceJan. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSL143
Plasmid#252946PurposeChloramphenicol-resistant empty vector for Lactiplantibacillus plantarumDepositorArticleTypeEmpty backboneExpressionBacterialAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSL168
Plasmid#252942PurposeChloramphenicol-resistant empty vector for Lactococcus lactisDepositorArticleTypeEmpty backboneExpressionBacterialAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTuLys2CMR2
Plasmid#53544PurposeInhibition module. Constructed from the parent plasmids pLuxRI, pLuxmCherry, pET15bLCFPT7, and pLysS. The plasmid can express T7 lysozyme by inducing AHL and LuxR. Chloramphenicol resistanceDepositorInsertpLux
UseUnspecifiedAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
DVC_p15A_AF
Plasmid#217588PurposeDestination vector with chloramphenicol resistance and p15A origin of replication. Carries A-F CIDAR MoClo overhangs for level 1 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGLU_66
Plasmid#225769PurposeThis is the native promoter from the catP chloramphenicol resistance cassette.DepositorInsertPcatP_[abr]
UseSynthetic BiologyMutationN/AAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVP077
Plasmid#222029PurposeEmpty Kanamycin resistant GreenGate destination vector based on pGGP-AG. Domesticated of Esp3I sites in the backbone and chloramphenicol resistance gene.DepositorTypeEmpty backboneUseSynthetic Biology; Greengate compatible cloning v…MutationAll Esp3i sites domesticatedAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLT06
Plasmid#255019PurposeMarkerless deletion vector that enables manipulation of enterococcus to either insert DNA or delete DNA from the genome. Contains resistance gene for chloramphenicol resistance.DepositorTypeEmpty backboneAvailable SinceMay 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
PtetA with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225644PurposetetA promoter expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInserttetR/tetA
TagsmCherryExpressionBacterialPromotertetA promoterAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLac0301 with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225643PurposeLac0301 promoter expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInsertLacO3O1
TagsmCherryExpressionBacterialPromoterLacO3O1 promoterAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
ParaBAD with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225642PurposearaBAD promoter expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInsertaraBAD
TagsmCherryExpressionBacterialPromoterBAD promoterAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAmScarletCm
Plasmid#206818PurposeTemplate for hlpA-mScarlet-I amplification associated with chloramphenicol resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmScarletAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAYFPCm
Plasmid#206826PurposeTemplate for hlpA-YFP amplification associated with chloramphenicol resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsYFPAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAmNeonGreenCm
Plasmid#206814PurposeTemplate for hlpA-mneongreen amplification associated with chloramphenicol resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmNeonGreenMutation3insGAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
DVC_p15A_AE
Plasmid#217587PurposeDestination vector with chloramphenicol resistance and p15A origin of replication. Carries A-E CIDAR MoClo overhangs for level 1 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only