We narrowed to 8,092 results for: siae
-
Plasmid#231857PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoEDDepositorInsertGcn4 ILVtoED
Tags6xHis, TEV cleavage siteExpressionBacterialMutationL123D, I128E, V130E, V135E, L137D, I142DPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAM72
Plasmid#227622PurposepETDuet-1 Rpn8(1-179)-precission-Strep, H6-precission-Rpn11(2-239, G77P)DepositorTagsHis-PrescissionExpressionBacterialMutation1-179 and aa 2-239, G77PPromoterT7Available SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM315 pACYC-His6-Rpn10[ΔUIM]
Plasmid#226348PurposeExpression of yeast Rpn10 with the UIM deletedDepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSeLEU2
Plasmid#224870PurposeDisruption of S. eubayanus type LEU2 genesDepositorInsertpYAMTr2GC having the guide sequence SeLEU2 (DI49_0736 Budding Yeast)
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1559
Plasmid#218590PurposeExpress peroxisomal Idi1p, Erg20(F96W,N127W)p, and GESp to convert IPP to geraniol with cytosolic Erg20 homodimerDepositorInsertGES
TagsePTS1ExpressionYeastMutationErg20(F96W, N127W), Erg20-Erg20 synthetic homodim…Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
300_pETcon_SARS2_FLip
Plasmid#222230Purposeyeast surface display of the SARS-CoV-2 FLip variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
297_pETcon_SARS2_Omicron-BA286
Plasmid#222231Purposeyeast surface display of the SARS-CoV-2 BA.2.86 variant RBDDepositorInsertSARS-CoV-2 BA.2.86 RBD (S SARS-CoV-2 virus, Budding Yeast)
TagsHA and c-MycExpressionYeastAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
299_pETcon_SARS2_EG-5
Plasmid#222232Purposeyeast surface display of the SARS-CoV-2 EG.5 variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-ScChd1[Y137A]
Plasmid#221198PurposeScChd1-aa118-1274 chromatin remodeler with Y137A mutationDepositorInsertScChd1 (aa118-1274)
Tags6xHis-tag (Precission protease cleavable)ExpressionBacterialMutationY137APromoterT7Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-28a (+)-Gal4-p53
Plasmid#171076PurposeExpresses Gal4-p53 fusion protein in bacteriaDepositorInsertGal4 DBD (NEWENTRY Budding Yeast)
TagsHis and p53(1-85)ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
RT-4
Plasmid#220443PurposeConstruct used to generate the PUF3/PUP2/3HA tagging strains. Surrounding the PUP2/3HA/URA3 are large regions of homology to integrate at the 3’ end of the PUF3 gene.DepositorAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
BS-TRP1-PGAL-GFP-Cps1
Plasmid#207030PurposeExpression of GFP-Cps1 under GAL promoter.DepositorInsertCps1
TagsGFPExpressionYeastPromoterGAL1Available SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only