We narrowed to 5,487 results for: Mos
-
Plasmid#69253Purposephlh-8::CRE for integration on ttTi14024, Chr XDepositorInsertCre recombinase
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterhlh-8Available SinceOct. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB330
Plasmid#68658PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagstdTomatoExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GFP (F64L, S65T, V163A)-kanMX6
Plasmid#53183Purposechromosomal tagging with stable GFPDepositorInsertkanMX6
UseYeast genomic targetingTagsGFP (F64L, S65T, V163A)Available SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-C11orf83-V5
Plasmid#65843PurposeMammalian expression of C terminally V5-tagged C11orf83/UQCC3DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTUT6
Plasmid#60043PurposeMammalian expression of FLAG-tagged mouse TUT6DepositorAvailable SinceNov. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCALNL_Ch10
Plasmid#81224PurposepCALNL reporter contains two target sites consisting of PAM Cas9 site-gix psuedo site-Cas9 site-PAM that match region in PCDH15 locus on chromosome 10DepositorInsertgix-Neo-gix deletion cassette upstream of EGFP
ExpressionMammalianPromoterpCBaAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSR21
Plasmid#69156Purposeread-outlox2272 mCherry to tagBFP switch for integration on ttTi14024, Chr XDepositorInsertsmCherry
TagBFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterrps-27Available SinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGWB560-NADK2
Plasmid#203760PurposeFor Agrobacterium transformation. tagRFP fused Arabidopsis thaliana NAD KINASE2 (NADK2) under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertNAD KINASE2
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-UnaG-FLAG
Plasmid#203479PurposeFor Agrobacterium transformation. A plastid transit peptide fused UnaG-FLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertPlastid transit peptide fused UnaG-FLAG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-tagRFP
Plasmid#203482PurposeFor Agrobacterium transformation. tagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertTagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag.
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMLS640
Plasmid#188892PurposettTi5605 MosSci targeting vector with Pmex-5::Cas9 and floxed Cbr-unc-119 markerDepositorInsertPmex-5::Cas9, Cbr-unc-119
ExpressionWormMutationC. elegans codom optimization and intron additionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lmajor_gp63_10_0460_P460G_D463N_S465A
Plasmid#171645PurposeExpression of L. major glcyoprotein-63 (P460G_D463N_S465A) with substrate binding site mutations from chromosome 10 in mammalian cellsDepositorInsertLmjF.10.0460 P460G D463N S465A
TagsMyc-HisExpressionMammalianMutationP460G; D463N; S465AAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT.334
Plasmid#119556PurposeLevel T acceptor vector for chromosomal integration with lacZ compatible with blue/white screening. Modified pUC19 vector.DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CTP-fluoA
Plasmid#117990PurposeChloroplast-targeted expression of CURT_fluoA controlled by the CaMV 35S promoterDepositorInsertCTP-CURT_fluoA
UseSynthetic Biology; Plant/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CTP-fluoB
Plasmid#117991PurposeChloroplast-targeted expression of CURT_fluoB controlled by the CaMV 35S promoterDepositorInsertCTP-CURT_fluoB
UseSynthetic Biology; Plant/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CTP-fluoE
Plasmid#117992PurposeChloroplast-targeted expression of CURT_fluoE controlled by the CaMV 35S promoterDepositorInsertCTP-CURT_fluoE
UseSynthetic Biology; Plant/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CURT_flouB
Plasmid#117995PurposeExpression of CURT_flouB controlled by the CaMV 35S promoterDepositorInsertCURT_flouB
UseYeast/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB6637
Plasmid#106164PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6681 into Yarrowia lipolytica chromosomal location IntE_3, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -