168,321 results
-
Plasmid#49246Purposeencodes enhanced green fluorescent protein (EGFP)DepositorInsertEGFP
ExpressionMammalianPromoterSV40Available SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Toronto KnockOut version 3 library (TKOv3)
Pooled Library#90294PurposeOptimized library offering improved accuracy, efficiency, and scalability for CRISPR screens compared to TKOv1DepositorAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HT JS-Rab10wt
Plasmid#135557PurposeExpress mouse Rab10wt in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Rab10wt.DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIBA2-Int-SpyTag
Plasmid#198038PurposeExpression plasmid for producing SpyTagged stalled secretion variant of intiminDepositorInserteaeA
TagsSpyTagExpressionBacterialMutationlacks native signal peptide (amino acids 1-39)PromotertetAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFD4d-U6-1:white1-U6-3:white1
Plasmid#84005PurposepCFD4d expresses white sgRNA-1 from a U6:3 promoter and the same white sgRNA-1 from a U6:1 promoterDepositorInsertswhite sgRNA-1
white sgRNA-1
UseCRISPRPromoterU6:1, U6:3, and dU6-1; dU6-3Available SinceJan. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
SCP1-CMVenh-luc
Plasmid#22216DepositorInsertSCP1 (super core promoter 1)-CMVenh luciferase
UseLuciferaseExpressionMammalianAvailable SinceApril 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pYZ183
Plasmid#98425PurposePombe Expression Vector - nmt41 promoter with empty BsaI-pad - no markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ184
Plasmid#98426PurposePombe Expression Vector - nmt81 promoter with empty BsaI-pad - no markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF3549
Plasmid#145025PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens. This is the control vector for the collection.DepositorInsertGFP
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pCI-syn-fRCaMP2
Plasmid#125246PurposeExpresses red fluorescent calcium sensor in hippocampal slicesDepositorInsertfRCaMP2
ExpressionMammalianMutationD396APromotersynapsinAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pD434-SR mouse Alpha-synuclein
Plasmid#89073Purposebacterial expression of mouse Alpha-synucleinDepositorAvailable SinceMarch 17, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVITRO-HPV8 L1L2
Plasmid#52598PurposeExpresses HPV8 L1 and L2 in mammalian cellsDepositorInsertsHPV8 L1
HPV8 L2
ExpressionMammalianAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGFP-C-IFT74
Plasmid#218730PurposeExpresses N-terminally EGFP-tagged IFT74 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1 (-) + codon optimized Brn3a
Plasmid#86829Purposemammalian expression of the transcription factor Brn3aDepositorAvailable SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 mouse PARG (439-959)
Plasmid#132615Purposeexpresses mouse PARG(439-959) in E. coli.DepositorInsertPARG (439-959)
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV8)
Viral Prep#20297-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT-Lyn11-mEGFP-cpHalo∆-(GGS)9-FKBP-P2A-Hpep3-(GGS)3-FRB-mScarlett
Plasmid#205703PurposeCMV driven co-expression of split HaloTag FKBP- and FRB-fusions (Lyn11-EGFP-FKBP-cpHalo∆ and Hpep1-FRB-mScarlett) in mammalian cell linesDepositorInsertLyn11-EGFP-FKBP-cpHalo∆-P2A-Hpep1-FRB-mScarlett
ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
HC87 pEYFPN1 anti-Homer1 nanobody
Plasmid#135223PurposeMammalian expression of anti-Homer1 (Mouse) recombinant llama nanobody for use as an intrabodyDepositorInsertanti-Homer1 (Mouse) recombinant llama nanobody HC87 (Homer1 L. glama (llama))
Tags6xHis-HA-EYFPExpressionMammalianAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only