We narrowed to 33,582 results for: Eng
-
Plasmid#48813PurposeProvides the AP3 promoter as GreenGate module.DepositorInsertAP3 promoter
UseGolden gate compatible cloning vectorMutationinternal BsaI recognition site removed by substit…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
human pirh2-(1-137)
Plasmid#24879DepositorAvailable SinceAug. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
human pirh2-(1-195)
Plasmid#24880DepositorAvailable SinceAug. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4G
Plasmid#104502PurposeUsed to evaluate the expression output of Saccharomyces cerevisiae PGM2 promoter with yEGFP used as the reporter geneDepositorInsertScPGM2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4K
Plasmid#104506PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL1 promoter with yEGFP used as the reporter geneDepositorInsertSpGAL1 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4O
Plasmid#104510PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSpdGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4P
Plasmid#104511PurposeUsed to evaluate the expression output of Saccharomyces pastorianus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSptGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
GoldenPiCS Kit
Plasmid Kit#1000000133PurposeA flexible modular system for advanced strain engineering in Pichia pastoris to accomplish pathway expression, protein production, or other DNA integration applications.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeYeast ExpressionCloning TypeGolden GateAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Yarrowia lipolytica Golden Gate tool kit
Plasmid Kit#1000000167PurposeStandardized parts that can be used for one-step integrative vector assembly of up to three transcription units for engineering Yarrowia lipolytica strains.DepositorApplicationCloning and Synthetic BiologyVector TypeYeast ExpressionCloning TypeGolden GateAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
EKAREN5-gl
Plasmid#225958PurposeThe YPet and mTurquoise sequence cassettes in EKAREN5(Addgene 167821) were replaced with a synonymous codon variant of YPet and mTurquoise-gl and subcloned into pCSII lentiviral backbone.DepositorInsertEKAREN5-gl
UseLentiviralTagsnls localization motifExpressionMammalianPromoterEF-1-alpha promoterAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
T2A GFP H2B
Plasmid#227722PurposePlasmid contains T2A GFP H2B, with some nlp-51 homology sequence before, Amp ResistantDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c
Plasmid#107599PurposeAn entry vector with U6a and U6c promoter driving guide RNAs expressionDepositorInsertsU6a promoter
U6c promoter
UseCRISPRAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK_BsmBI_LacZ_Cherry_Nanotag_117
Plasmid#130552PurposeEnhancer cloning nanotag reporter vectorDepositorInsertLacZ
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTK_BsmBI_LacZ_Cerulean_Nanotag_89
Plasmid#130538PurposeEnhancer cloning nanotag reporter vectorDepositorInsertLacZ
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTK_Citrine_Nanotag_32_neg_Control
Plasmid#130563PurposeEnhancer cloning nanotag reporter vectorDepositorInsertnegative oligo sequence
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTK_BsmBI_LacZ_Citrine_Nanotag_18
Plasmid#130519PurposeEnhancer cloning nanotag reporter vectorDepositorInsertLacZ
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTK_Cerulean_Nanotag_91_positive_Control
Plasmid#130572PurposeEnhancer cloning nanotag reporter vectorDepositorInsertFoxD3_cranial_neural_crest_enhancer_NC3
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceNov. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT31
Plasmid#223403PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only