We narrowed to 11,578 results for: VARS
-
Plasmid#212007PurposeExpression of mouse talin1 (1-490 + 1974-2541)-mCherry in mammalian cellsDepositorInsertTalin1(ΔR1-10)-mCherry (Tln1 Mouse)
UseTagsmCherry fluorescent proteinExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLINE1mORF1-ΔORF2-scFvFc
Plasmid#206023PurposeThe base next to the ORF1 start codon (ATG) was deleted in pLINE1ΔORF2-scFvFcDepositorInsertmouse LINE1 vector harboring an scFv-Fc expression unit, encoding mutated ORF1 but lacking ORF2
UseTagsExpressionMammalianMutationPromoterAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNK005C_BattB_mkozak_STIM1_IRES_mCherry-H2A-P2A-PuroR
Plasmid#200639PurposeLow STIM1 abundance recombination plasmid for Matreyek Bxb1(GT) landing pad in dual landing pad cellsDepositorAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:LYK5_At-3xHA
Plasmid#202192PurposeExpress Arabidopsis thaliana LYK5 gene under UBQ10 promoterDepositorInsertLYSM-CONTAINING RECEPTOR-LIKE KINASE 5 (LYK5 Mustard Weed)
UseTagsHAExpressionPlantMutationPromoterAtUBQ10Available SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
UseTagsExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#1
Plasmid#197421PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#2
Plasmid#197422PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#3
Plasmid#197423PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#1
Plasmid#197424Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #1 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2
Plasmid#197425Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #2 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet_Seq1.2
Plasmid#201404PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet-Seq1.1
Plasmid#201401PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/Col1a1/GFP4_Seq 1.1
Plasmid#201400PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-In18runon-PTPN22
Plasmid#195377PurposeA human PTPN22 mutant (intron 18-runon) in Gateway pDONR221DepositorInsertPTPN22 (PTPN22 Human)
UseGateway donor vectorTagsExpressionMutationIntron 18-runon PTPN22PromoterAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2 (K57A)
Plasmid#197118PurposeExpression of kinase-defective MYC-tagged PSK2 (K57A) / TAOK1 (K57A) in mammalian cellsDepositorInsertTAOK1 (K57A) (TAOK1 Human)
UseTagsMycExpressionMammalianMutationChanged K 57 to APromoterSV40Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-In18runon-PTPN22
Plasmid#195379PurposeMammalian expression of a human PTPN22 mutant (intron 18-runon) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
UseTagsFLAGExpressionMammalianMutationIntron 18-runon PTPN22PromoterAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-PTPN22
Plasmid#195375PurposeMammalian expression of a human PTPN22 mutant (exon 1-17) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
UseTagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17PromoterAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-γ1
Plasmid#197078PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 γ1 fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-1 γ1 (Ap1g1 Mouse)
UseTagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationPromoterADH1Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyTagsExpressionBacterial and YeastMutationPromoter2xLexop-minimalCyc1 and PACT1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVTagsExpressionMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only