We narrowed to 6,287 results for: tTA
-
Plasmid#199640PurposesgRNA guide against VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgINTS12 guide 1
Plasmid#193606PurposeINTS12 knockoutDepositorInsertsgINTS12 guide 1 (INTS12 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-2
Plasmid#124475PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-2_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-3
Plasmid#124476PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-3_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pvLEA22mer_shuffle_3_mCh-2xFKBP (pBS1119)
Plasmid#185314PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA2
Plasmid#186664PurposeNbr C-tag sgRNA2 plasmidDepositorInsertNbr sgRNA 2 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA1
Plasmid#186663PurposeNbr C-tag sgRNA1 plasmidDepositorInsertNbr sgRNA 1 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
ApoE3_D125I_mCh-2xFKBP (pBS1157)
Plasmid#185330PurposeFor the mammalian expression of the human protein ApoE3_D125I attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertApoE3_D125I
ExpressionMammalianMutationD125IAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_mCh-2xFKBP (pBS1156)
Plasmid#185329PurposeFor the mammalian expression of the human protein ApoE3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertApoE3
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAHS1_PARRC_101-189_mCh-2xFKBP (pBS1136)
Plasmid#185320PurposeFor the mammalian expression of the tardigrade protein CAHS1_PARRC_101-189 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertCAHS1_PARRC_101-189
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
SYUA_HUMAN_mCh-2xFKBP (pBS1135)
Plasmid#185319PurposeFor the mammalian expression of the human protein SYUA_HUMAN attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertSYUA_HUMAN
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_3_mCh-2xFKBP (pBS1123)
Plasmid#185318PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_mutant_3
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k5_1_mCh-2xFKBP (pBS1122)
Plasmid#185317PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertPvLEA4_repeats_k5_1
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_10_mCh-2xFKBP (pBS1121)
Plasmid#185316PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_10 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_mutant_10
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAHS2_PARRC_98-130_mCh-2xFKBP (pBS1120)
Plasmid#185315PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC_98-130 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertCAHS2_PARRC_98-130
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-2xFKBP (pBS1118)
Plasmid#185313PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k3_26 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertPvLEA4_repeats_k3_26
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only