We narrowed to 6,267 results for: cat.2
-
Plasmid#167295PurposePlasmid encoding for 2 gRNAs targeting the human BAK gene and a CMV driven nuclease Cas9 followed by self-cleaving mCherryDepositorInsertBAK (BAK1 Human)
ExpressionMammalianAvailable SinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
Y587E EphA2 pcDNA3
Plasmid#102730PurposeExpression of EphA2 in mammalian cellsDepositorAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
Y921F EphA2 pcDNA3
Plasmid#102736PurposeExpression of EphA2 in mammalian cellsDepositorAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Y771F EphA2 pcDNA3
Plasmid#102735PurposeExpression of EphA2 in mammalian cellsDepositorAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Y593E EphA2 pcDNA3
Plasmid#102731PurposeExpression of EphA2 in mammalian cellsDepositorAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;dll4CE2-P1Egfp
Plasmid#90147Purposecontains dll4 enhancer 2 sequence, and dll4 specific gene promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;dll4CE2-basEgfp
Plasmid#90144Purposecontains dll4 enhancer 2 sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
RHO3
Bacterial Strain#124700PurposeE. coli mobilizer strain that facilitates conjugation of mobilizable plasmids by using metabolic counter-selection against the donor strain.DepositorBacterial ResistanceDAP (400 µg/ml)Available SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
V. natriegens NC7
Bacterial Strain#215356PurposeVibrio natriegens with genomically integrated natural competence regulator, TfoX. For zero-capital molecular biology applications.DepositorBacterial ResistanceNoneAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_mScarlet_CLASP_RGS2membrane
Plasmid#133086PurposePlasmid contains mScarlet with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-mScarlet-yeLANS). CLASP modulates nuclear localization of mScarlet in response to blDepositorInsertmScarlet-CLASP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Hygromycin-TTF-1
Plasmid#119173PurposeRetroviral mammalian expression vector containing wt-human TTF-1 cDNADepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF-DEST51 HA-PNRC1
Plasmid#123294PurposeMammalian expression of PNRC1 N-HADepositorAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm2
Plasmid#222912PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 2 (NPM2 Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
(I) pADH2 (J) P3 (SBE114)
Plasmid#187629Purposepromoter of the gene alcohol dehydrogenase 2 from R. toruloides for the P3 position (I/J)DepositorInsert(I) pADH2 (J)
ExpressionBacterialAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
(F) pADH2 (G)_P2 (SBE113)
Plasmid#187628Purposepromoter of the gene alcohol dehydrogenase 2 from R. toruloides fro the P2 position (F/G)DepositorInsert(F) pADH2 (G)
ExpressionBacterialAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
(F) pXYL (G) P1 (SBE216)
Plasmid#195017Purposepromoter of the gene xylose reductase from R. toruloides for the position P2 (F/G)DepositorInsert(F) pXYL (G)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(R) pXYL (D) P1 (SBE215)
Plasmid#195016Purposepromoter of the gene xylose reductase from R. toruloides for the position P1 (R/D)DepositorInsert(R) pXYL (D)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only