We narrowed to 9,991 results for: FIE
-
Plasmid#192493PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K519TAG)-HA
Plasmid#239775PurposeExpresses rat NF186 with a TAG codon at position 519 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K534TAG)-HA
Plasmid#239776PurposeExpresses rat NF186 with a TAG codon at position 534 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K571TAG)-HA
Plasmid#239777PurposeExpresses rat NF186 with a TAG codon at position 571 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K604TAG)-HA
Plasmid#239778PurposeExpresses rat NF186 with a TAG codon at position 604 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K680TAG)-HA
Plasmid#239779PurposeExpresses rat NF186 with a TAG codon at position 680 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K809TAG)-HA
Plasmid#239780PurposeExpresses rat NF186 with a TAG codon at position 809 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgNon-targeting
Plasmid#233244PurposeKnock out - non targeting controlDepositorInsertnon targeting control sgRNA
UseLentiviralAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCrhaB2_ApyOAHIDS
Plasmid#226246PurposeProduction of ApyA peptide modified by the B12-rSAM enzyme ApyD (optional, refer to publication), the cytochrome P450 enzyme ApyO, and the MNIO enzyme ApyHI, and the methyltransferase ApySDepositorInsertsHis6_ApyA
ApyD
ApyO
ApyH
ApyI
ApyS
TagsHexa-HistidineExpressionBacterialAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCrhaB2_ApyOAHID
Plasmid#226245PurposeProduction of ApyA peptide modified by the B12-rSAM enzyme ApyD (optional, refer to publication), the cytochrome P450 enzyme ApyO, and the MNIO enzyme ApyHIDepositorInsertsHis6_ApyA
ApyD
ApyO
ApyH
ApyI
TagsHexa-HistidineExpressionBacterialAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2117-FKBP-GPA-114-RH-CyOFP1
Plasmid#222884PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, RH linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-RH-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2116-FRB-GPA-114-RH-CyOFP1
Plasmid#222883PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, RH linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-RH-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2379-FKBP-GPA(V84R)-20-11S
Plasmid#222901PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 11SDepositorInsertFKBP-GPA(V84R)-20GS-NanoLuc11S
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2380-FKBP-GPA(V84R)-20-114
Plasmid#222900PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 114DepositorInsertFKBP-GPA(V84R)-20GS-NanoLuc114
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2378-FRB-GPA(V84R)-20-11S
Plasmid#222899PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFRB-GPA(V84R)-20GS-NanoLuc11S
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2377-FRB-GPA(V84R)-20-114
Plasmid#222898PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFRB-GPA(V84R)-20GS-NanoLuc114
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2132-FKBP-GPA-114-5-CyOFP1
Plasmid#222891PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2127-FRB-GPA-114-20-CyOFP1
Plasmid#222886PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2129-FRB-GPA-114-5-CyOFP1
Plasmid#222888PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2128-FRB-GPA-114-10-CyOFP1
Plasmid#222887PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2131-FKBP-GPA-114-10-CyOFP1
Plasmid#222890PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2130-FKBP-GPA-114-20-CyOFP1
Plasmid#222889PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Amber-free HIV-1 deltaRT
Plasmid#213007PurposeAn replication-incompetent amber-free HIV-1 encodes full-length Env BG505 with RT-deleted Q23 as the backbone.DepositorInsertsHIV-1 Q23 ΔRT backbone (reverse transcriptase is deleted)
Env BG505
UseUnspecifiedAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDUET-GST AO7RE ∆238-245
Plasmid#139318PurposeGST tagged AO7 encoding aa 126-258 with an internal deletion that results in loss of E2 binding for expression in bacteriaDepositorInsertAO7 aa 126-258 (RNF25 Human)
TagsGSTExpressionBacterialMutationAO7 cloned into the first multiple cloning site o…PromoterT7 promoter-1Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 HEK3 PegRNA
Plasmid#206277PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes HEK3 PegRNADepositorInsertHEK3 PegRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
YW347_Ptbb2UTR-loxP-RFP-miniMOS
Plasmid#196064Purposea plasmid modified from miniMOS vector pCFJ910. the modification including insertions of myo2p::TagRFP downstream to NeoR CDS and 2 loxP sites flanking the NeoR and tagRFP cassettes.DepositorInsertsmyo2p driven tagRFP
NeoR
Minimal Mos1
ExpressionWormPromotermyo-2Available SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iEscSnFR_PM
Plasmid#182813PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_PM
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iEscSnFR_cyto
Plasmid#182814PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_cyto
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only