We narrowed to 5,505 results for: crispr cas9 grna plasmid
-
Plasmid#227318PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of TP53 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pX330-EZR
Plasmid#227293PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of EZR for knock-in.DepositorAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
5xtetO (tet3) Gene Desert
Plasmid#131339PurposegRNA to insert 5xTet operator sequence into a gene desert on chromosome 5.DepositorInsertDesert-gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
5xtetO HoxC 3'
Plasmid#131340PurposegRNA to insert 5xTet operator sequence into downstream of HoxC cluster.DepositorInsertHoxC-downstream-gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
EED-F97A
Plasmid#131326PurposegRNA to generate F97A cage-mutant EEDDepositorInsertEED-KO-gRNA-2
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS143
Plasmid#122377PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
px459 sgAtg5
Plasmid#175023PurposeCRISPR-Cas9 plasmid targeting exon 2 of human Atg5.DepositorInsertATG5 (ATG5 Human)
ExpressionMammalianAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFA0057
Plasmid#131784PurposeGuide RNA (gGFP) and Cas9 expression plasmid for cleaving pFA6 series GFP C-terminal tagging cassettes, including GFP-His3MX6. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer GFP cassette guide (gGFP) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIA33
Plasmid#120803PurposeE. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfpDepositorInsertsdeactivated nuclease dCas9, codon-optimized for C. difficile
single guide RNA targeting red fluorescent protein
UseCRISPRExpressionBacterialMutationBase-pairing region targets red fluorescent prote…PromoterPgdh and PxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458-CCND1
Plasmid#172630PurposeExpresses a gRNA against CCND1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458-AMBRA1 #3
Plasmid#172607PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX459 mDnd1#1
Plasmid#106345Purposesmall guide RNA #1 against RRM-coding region of Dnd1 gene locusDepositorAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only