We narrowed to 11,306 results for: AGA
-
Plasmid#187266PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YD mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YD (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YF mCherry
Plasmid#187265PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YF mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YF (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-FLAG-Jhdm2a
Plasmid#38136DepositorInsertJhdm2a (Kdm3a Mouse)
TagsFLAGExpressionMammalianMutationprotein starts at aa115PromoterCMVAvailable SinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2s-Calnexin-N-14
Plasmid#231768PurposeVisualization of ER in mammalian cells using mGold2sDepositorInsertmGold2s-Calnexin-N-17 (CANX Human)
TagsmGold2sExpressionMammalianMutationI474NPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBK- Ma PylRS WT
Plasmid#197573PurposeExpresses wild-type Methanomethylophilus alvus pyrrolysine tRNA synthetase under GlnS promoter. Used for Pyl tRNA-synthetase selections.DepositorInsertM. alvus PylRS WT
ExpressionBacterialPromoterGlnS (constitutive)Available SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK3/PERK_sgRNA
Plasmid#218666PurposesgRNA targeting human EIF2AK3/PERKDepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2t-Lysosome-N-20
Plasmid#231778PurposeVisualization of lysosome in mammalian cells using mGold2tDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-TRIM33
Plasmid#65398PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry-CRM1
Plasmid#237646PurposeFor overexpression of mCherry-CRM1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBW2614_pCAG-PV1-GAI-L2-28-396-FlpO-ABI-NLS-BGHpA
Plasmid#108833PurposeExpresses aa28 to aa396 of Flp recombinase fused to GAI and ABI CIDsDepositorInsertFlp recombinase fragment aa28 to aa396
UseCre/Lox and Synthetic BiologyTagsABI,NLS and GAIExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 2 HH06 pFUSE-IgG1-Knob-mutation knob-clone6
Plasmid#192184PurposeClone 16 (HH06) pFUSE-IgG1-Knob-mutation knob-clone6DepositorInsertClone 6 heavy chain (HH06)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 1 HH02 pFUSE-IgG1-Hole mutation-hole-clone2
Plasmid#192183PurposeClone 16 (HH02) pFUSE-IgG1-Hole mutation-hole-clone2DepositorInsertClone 2 heavy chain (HH02)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ΞΆ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.0-TERT G228A
Plasmid#84926Purposeluciferase reporter for mutant TERT promoterDepositorInsertTERT promoter (TERT Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationG228APromoterTERTAvailable SinceMarch 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-MDA5-S88D
Plasmid#174226PurposeExpresses human MDA5 S88D mutantDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.0-TERT G250A
Plasmid#84925Purposeluciferase reporter for mutant TERT promoterDepositorInsertTERT promoter (TERT Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationG250APromoterTERTAvailable SinceMarch 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-U6-sgRNA-BFP-Puro
Plasmid#229014PurposePerturb Seq lentiviral sgRNA vectorDepositorTypeEmpty backboneUseLentiviralAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLX_307 FDX1
Plasmid#184495PurposeLentivirus expression for FDX1DepositorInsertFDX1 (FDX1 Human)
UseLentiviralAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-R1441C
Plasmid#25046DepositorAvailable SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only