We narrowed to 2,781 results for: PREP
-
Plasmid#228577PurposeExpresses mouse TMEM16F-I521A-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521A plus a 3 amino acid N-terminal truncation (…Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TMEM16F-I521E-peGFP-N1
Plasmid#228578PurposeExpresses mouse TMEM16F-I521E-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521E plus a 3 amino acid N-terminal truncation (…Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-DXO
Plasmid#177993PurposeFor purification of N-terminally His-tagged DXO from bacteriaDepositorAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-EED-2A-mTurquoise
Plasmid#225692PurposeLentiviral expression of rTetR(SE) fused to EED and mTurquoise-NLSDepositorInsertrTetR-EED (EED Human, Synthetic)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-HP1a-2A-mTurquoise
Plasmid#225691PurposeLentiviral expression of rTetR(SE) fused to HP1a and mTurquoise-NLSDepositorInsertHP1a (CBX5 Human, Synthetic)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET3a.H2B-K120C
Plasmid#224706PurposeExpresses Human H2B K120C mutant in bacterial cells for fluorescent labelling of histone octamersDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-TetOn-mCherry-OAZ1_FS-YFP
Plasmid#232356PurposeMammalian expression of dox-inducible polyamine sensor (polyamine levels = YFP/Cherry)DepositorInsertOAZ1 derived polyamine sensing module (OAZ1 Human)
UseLentiviralTagseYFP and mCherryExpressionMammalianPromoterTRE3GAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-PinkyCaMP
Plasmid#232856PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under hSyn promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterhSynAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-sgRNA-BFP-Puro
Plasmid#229013PurposePerturb Seq sgRNA vector with PiggyBac backboneDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-PinkyCaMP
Plasmid#232860PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CAG promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-PinkyCaMP
Plasmid#232858PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CaMKII promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-gfaABC1D-PinkyCaMP
Plasmid#232859PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under gfaABC1D promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromotergfaABC1DAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hSFTPCpromoter(2kb)-EGFP-EF1a-TagRFP
Plasmid#201681PurposeLentiviral vector for human SFTPC promoter (2kb)-driven expression of EGFP and EF1a-driven TagRFP expressionDepositorInsertsSFTPC promoter region (2kb upstream)
TagRFP
UseLentiviralExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xFLAG-LigD-IRES-tdTomato
Plasmid#234951PurposeHuman codon optimized LigD (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInsertHuman codon optimized LigD with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1AAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-FLAG-SQSTM1
Plasmid#223715PurposeExpresses Flag-tagged SQSTM1DepositorAvailable SinceAug. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
hnRNPA1-FLAG-IRES-eGFP
Plasmid#234619PurposeMammalian expression of full-length hnRNPA1 with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationC-terminal FLAG tag, co-expressing with eGFP via …PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
prhaBAD-anti-mouse-Nb-Hia5
Plasmid#239626PurposeRhamnose inducible expression plasmid for anti-mouse nanobody fusion to Hia5 DNA adenine methyltransferaseDepositorInsertHia5
Tags6HIS, MBP, TEV, and anti-Mouse NanobodyExpressionBacterialMutationCodon optimized for bacterial expressionPromoterrhaBADAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2×FLAG-T4Lig-IRES-tdTomato
Plasmid#234952PurposeHuman codon optimized T4 DNA Ligase with N-terminal E1 MLS expressing plasmidDepositorInserthuman codon optimized T4 DNA Ligase with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1aAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xMyc-Ku-IRES-Hygro
Plasmid#234950PurposeHuman codon optimized Ku (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInserthuman codon optimized Ku with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsMycExpressionMammalianPromoterEF1aAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNA 3C myc scfvFLAG
Plasmid#234990PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti FLAG scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA-3C-myc-scfvFLAG
ExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET16b-PCNA
Plasmid#134898PurposeBacterial expression and purification of human PCNADepositorInsertPCNA (PCNA Human)
TagsuntaggedExpressionBacterialMutationfully synthetic, codon optimized for bacterial ex…PromoterT7Available SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-U6-sgRNA-BFP-Puro
Plasmid#229014PurposePerturb Seq lentiviral sgRNA vectorDepositorTypeEmpty backboneUseLentiviralAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO GFP11-LRRK2
Plasmid#231174PurposeExpresses GFP-11-LRRK2 (wildtype, full length) in mammalian cellsDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pet16b-Avi-ubiquitin_rbs_BirA
Plasmid#134897PurposeExpresses HIS-Avi-tagged ubiquitin for recombinant protein productionDepositorInsertsTags10HIS-AviTag-PreScission(3C)proteaseExpressionBacterialPromoterRBS and T7Available SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
CVS-N2c-RVdG-MCP:oScarlet-KASH_NoMBS
Plasmid#231014PurposeCVS N2c RVdG genome plasmid, utilized to generate negative control virus to benchmark the utility of MS2 tagging for capture of barcodes using snRNA-seq.DepositorInsertMCP-oScarlet-KASH
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only