We narrowed to 6,058 results for: cat.2
-
Plasmid#133793PurposeU6 promoter sgRNA entry vector used for all CjeCas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V2-TGAA linker sgRNA architecture from Kim et al. Nature Communications 2017DepositorInsertCjeCas9 sgRNA entry vector
ExpressionMammalianMutationV2-TGAA linker sgRNA architecture from Kim et al.…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagBFP-2A-IE1
Plasmid#235541PurposeTo express tagBFP-2A-IE1DepositorInsertIE1
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo-MORC3_gRNA_1
Plasmid#235529PurposegRNA against human MORC3DepositorInsertMORC3 (MORC3 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo-MORC3_gRNA_3
Plasmid#235530PurposegRNA against human MORC3DepositorInsertMORC3 (MORC3 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_IFNB1_gRNA_1
Plasmid#235532PurposegRNA against human IFNB1DepositorInsertIFNB1 (IFNB1 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_IFNB1_gRNA_3
Plasmid#235533PurposegRNA against human IFNB1DepositorInsertIFNB1 (IFNB1 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagBFP-2A-coICP0
Plasmid#235536PurposeTo express tagBFP-2A-coICP0 (co = codon-optimized)DepositorInsertICP0
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagRFP657-2A-coICP0
Plasmid#235538PurposeTo express tagRFP657-2A-coICP0 (co = codon-optimized)DepositorInsertICP0
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-443_Cacnes_HisB
Plasmid#225608PurposeSuicide C. acnes vector to generate HisB (PPA_RS05815) deletion leaving an Ery resistance cassette flanked by BxbI recombination sitesDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgSEC24D
Plasmid#231565PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human SEC24D (Puromycin selection marker)DepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pROS_phleo-Tps1/Gsy2
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-3
Plasmid#193701PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2delta
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only