We narrowed to 20,078 results for: INO
-
Plasmid#170068PurposeExpresses dCas9 repressor KRAB-dCas9-MeCP2 and blasticidin resistanceDepositorInsertKRAB-dCas9-MeCP2
UseCRISPR and LentiviralTags2A and 2xHA tagExpressionMammalianPromoterEFS-NSAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-CRY2-mCherry-MYPT169
Plasmid#178526PurposeExpresses CRY2-mCherry-MYPT (1-169 aa) in mammalian cellsDepositorInsertCRY2-mCherry-MYPT169
ExpressionMammalianPromoterCAGAvailable SinceDec. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/F-tractin=mStayGold
Plasmid#212019PurposeFor filamentous actin labeling. Alternatively, the F-tractin gene can be replaced with a target molecule gene for C-terminal tagging with mStayGold through a linker [(GGGGS)3] (denoted as ‘=’).DepositorInsertF-tractin
TagsmStayGoldExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJL1
Plasmid#69496PurposepJL1 expression vector with sfGFPDepositorInsertSuper folder GFP
ExpressionBacterialPromoterT7Available SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti.puro.MCV.ER.RAZ.2
Plasmid#114382PurposeThis lentiviral plasmid expresses MCV tumor T antigens (truncated LT and small T) using the viral NCCR (non-coding control region). The sequence was amplifeied from MCV.R17a and truncated LT=428 aa.DepositorInsertMCV NCCR and tumor T antigen regions
UseLentiviralExpressionMammalianPromoterMCV NCCR (viral own promoter)Available SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Km
Plasmid#207999PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
anti-FX(a) Emi HC
Plasmid#113665PurposeFor transient expression of Emicizumab sequence (CAS# 1610943-06-0, KEGG# D10821), IgG4 bispecific antibody targeting FIX(a) & FX(a). Must be co-expressed with the anti-FIX(a) Emi HC and the Emi LC.DepositorInsertEmicizumab anti-FX/FXa heavy chain
ExpressionMammalianPromoterCMV PromoterAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
anti-FIX(a) Emi HC
Plasmid#113664PurposeFor transient expression of Emicizumab sequence (CAS# 1610943-06-0, KEGG# D10821), IgG4 bispecific antibody targeting FIX(a) & FX(a). Must be co-expressed with the anti-FX(a) Emi HC and the Emi LC.DepositorInsertEmicizumab anti-FIX/FIXa heavy chain
ExpressionMammalianPromoterCMV PromoterAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Sm
Plasmid#208001PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET15b His-p97
Plasmid#169020PurposeExpresses His-p97 in bacteriaDepositorInsertp97
TagsHisExpressionBacterialPromoterT7Available SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Flag-hGSDMD
Plasmid#218938PurposeExpression of N-terminal FLAG tagged human gasdermin DDepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-NT sgRNA; EF1a-dCas9-KRAB-GFP
Plasmid#194284PurposeEF1a-dCas9-KRAB-GFP with nontarget sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
PG13-luc (wt p53 binding sites)
Plasmid#16442PurposeLuciferase reporter containing 13 copies of the p53-binding consensus sequenceDepositorAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-eGFP-dspB(E184Q W330Y)-6xHis
Plasmid#175801PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein eGFP-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAviTag, Hexahistidine tag, and eGFPExpressionBacterialMutationE184Q W330YPromoterT7Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1∆HisTag_hNMT_Nef
Plasmid#66078PurposeSingle vector system expressing hNMT1 (81-496 amino acids) and NEF allowing myristoylation of recombinant protein produce in Ecoli systemDepositorInsertsExpressionBacterialMutationDeletion of first 80 amino acidsPromoterT7-lacOAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/mStayGold(c4)=UtrCH
Plasmid#212020PurposeFor filamentous actin labeling. Alternatively, the UtrCH gene can be replaced with a target gene for N-terminal tagging with mStayGold via a c4 adaptor and a linker [(GGGGS)3] (denoted as ‘=’).DepositorInsertUtrCH
TagsmStayGold(c4)ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_ORI_empty
Plasmid#99297PurposeLuciferase validation vector; empty vector without insert to determine baselineDepositorTypeEmpty backboneUseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT-PB-CD2APtk
Plasmid#86004Purposehomology donor for AAT locus with piggyBac-flanked DsRedEx_T2A_puroTK cassetteDepositorInsertDsRedEx_T2A_puro_dTK
UsePiggybac exciseableExpressionMammalianPromoterCAGAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCH45 (multiAsCas12a-KRAB lenti)
Plasmid#217330PurposeLentiviral expression of multiAsCas12a-KRABDepositorInsertmultiAsCas12a
UseCRISPR and LentiviralTags6xMycNLS and HA-SV40NLS-XTEN80-KRAB-P2A-TagBFP2MutationR1226A/E174R/S542R/K548RPromoterUCOE-SFFVAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only