We narrowed to 7,945 results for: Lif;
-
Plasmid#241793PurposeExpression vector for mouse Pgc-1alpha with EYFPDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-EGFP
Plasmid#237858PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-mcherry
Plasmid#238009PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-pSyn_R-PTEN
Plasmid#227437PurposeExpression of the R-PTEN sensor under the Synapsin promoter in an AAV backboneDepositorInsertR-PTEN sensor (Pten Rat)
UseAAVTagsmCyRFP2 and mMaroonExpressionMammalianMutationR14GPromoterSynapsinAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2x3HA-T2A-Isl1
Plasmid#233161PurposeRetroviral expression of mNgn2x3HA and Isl1DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Isl1-T2A-mLhx3
Plasmid#233160PurposeRetroviral expression of Isl1 and Lhx3 for motor neuron specificationDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2x3HA-T2A-mLhx3
Plasmid#233162PurposeRetroviral expression of mNgn2x3HA and Lhx3DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-myrAkt-P2A-BCL2
Plasmid#233182PurposeRetroviral expression of myristoylated Akt1 (myr-Akt) and Bcl2DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro-Scrambled
Plasmid#47541PurposeTet inducible scrambled shRNA.DepositorInsertScrambled shRNA
UseLentiviral and RNAiExpressionMammalianPromoterH1Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
M22: pHR-SFFVp-NLS-iLID::EGFP::FTH1
Plasmid#122147PurposeSelf-assebled 24-mer tagged with NLS, iLID, and EGFP. Upon blue-light activation can bind up to 24 SspB-modified proteins.DepositorAvailable SinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-puro
Plasmid#167821PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOT_5 - lenti-EFS-FMC6.3-28z-2A-puro-2A-tNGFR
Plasmid#181974PurposeExpresses anti-CD19 CAR (with CD28 signaling domain) linked to puromycin resistance via P2A and to human truncated NGFR via T2A for lentiviral delivery.DepositorInsertFMC6.3-28z CAR; tNGFR (NGFR Synthetic, Human)
UseLentiviralMutationNGFR truncation: aa 11-276Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5(TA)-ires-puro
Plasmid#167823Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOT_6 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-tNGFR
Plasmid#181975PurposeExpresses anti-CD19 CAR (with 4-1BB signaling domain) linked to puromycin resistance via P2A and to human truncated NGFR via T2A for lentiviral delivery.DepositorInsertFMC6.3-BBz CAR; tNGFR (NGFR Synthetic, Human)
UseLentiviralMutationNGFR truncation: aa 11-276Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro-SOX2
Plasmid#47540PurposeTet inducible knockdown of SOX2.DepositorInsertSOX2 shRNA
UseLentiviral and RNAiExpressionMammalianPromoterH1Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Sox2 HM a
Plasmid#26353DepositorInsertSox2 shRNA
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-puro
Plasmid#167828PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X
Plasmid#225718PurposeBacterial expression of USP27X with HA tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-blast
Plasmid#167822PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only