We narrowed to 16,819 results for: OMP;
-
Plasmid#146766PurposeMammalian Expression of HsRRP12DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHsRRP12 (RRP12 Human)
ExpressionMammalianAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1(+)-cpPKN-mRuby2-GFP1-10
Plasmid#181859PurposePart of FluoSTEP-RhoA biosensor; must be expressed with GFP11-tagged RhoA plasmid (Addgene #181860) or in GFP11-RhoA gene-edited cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertcp-PKN-mRuby2-GFP(1-0)
TagsmRuby2 and sfGFP(1-10)ExpressionMammalianPromoterCMVAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP/golgin-160/3DE
Plasmid#180631PurposeExpression of caspase-resistant golgin-160DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgolgin-160/3DE (GOLGA3 Human)
TagsEGFPExpressionMammalianMutationD59E, D139E, D311EAvailable sinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pdpy-30-miniCAFE
Plasmid#170115PurposeDpy-30 promoter-driven expression of a truncated VPR-dCjCas9 fusion protein (MiniCAFE) for activation of gene expression.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMiniCAFE
UseCRISPRMutationD8A, HNH-truncation (Δ495–609 aa) in CjCas9PromoterDpy-30Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-I152L-GGGS-TDP43 M337V
Plasmid#162615PurposeAllows for transcription of improved mVenus I152L fluorophore half fused to mutant TDP-43-M337V for injection into zebrafish embryos for BiFC assaysDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTARDBP (TARDBP Human)
ExpressionMammalianMutationM337VAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS-TDP-43 M337V
Plasmid#162618PurposeAllows for transcription of mCerulean fluorophore half fused to mutant TDP-43-M337V for injection into zebrafish embryos for BiFC assaysDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTARDBP (TARDBP Human)
ExpressionMammalianMutationM337VAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-MHL: nsp16_SARS-CoV-2|nsp10_SARS-CoV-2
Plasmid#167849PurposeBacterial expression of the SARS-CoV-2 proteins nsp10 and nsp16 from a bicistronic mRNADepositorInsertnsp10, nsp16
Tags6xHis-TEVExpressionBacterialPromoterT7Available sinceApril 22, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Nsp13 K289A-EGFP
Plasmid#165130Purposemammalian expression and localizationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNsp13 K289A (ORF1ab codon optimized SARS-COV-2)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon/Von GCaMP 6m
Plasmid#137165PurposeIntersectional viral expression of GCaMP6M in cells expressing Cre AND Flp AND VcreDepositorInsert3x-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEf1aAvailable sinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetBl-CLIP-CPAP
Plasmid#136864PurposeMammalian expression of the centrosomal protein CENPJ N-terminally fused to CLIP-tagDepositorInsertCLIP-CENPJ (CENPJ Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetD-SNAP-Centrin2
Plasmid#136785PurposeMammalian expression of the centrosomal protein Centrin2 N-terminally fused to SNAP-tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSNAP-Centrin2 (CETN2 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available sinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Cep41
Plasmid#136794PurposeMammalian expression of the centrosomal protein Cep41 N-terminally fused to SNAP-tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSNAP-Cep41 (CEP41 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-HsSAS6
Plasmid#136789PurposeMammalian expression of the centrosomal protein SAS6 N-terminally fused to SNAP-tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSNAP-SAS6 (SASS6 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mIRFP670nuc-TEV-Xph20-ETWV
Plasmid#133044PurposeExpresses Xph20-ETWV in mammalian cells with nuclear miRFP670 as reporterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertXph20-ETWV
TagsNLS, TEV protease + TEV cleavage site, and miRFP6…ExpressionMammalianMutationS63KPromoterCAGAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p231-pOsAct1::hpt-pZmUbi::BdPetC-p35S::mTurquoise
Plasmid#129650PurposeRieske FeS overexpressionDepositorInsertCDS of PetC gene encoding for the Rieske FeS subunit
ExpressionPlantMutationCodon modified for Golden GatePromoterpZmUbiAvailable sinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
Brg1 Del1 pET28a
Plasmid#122115PurposeExpression Brg1 amino acids 1-381 in bacteriaDepositorAvailable sinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-RNAi-nucEGFPmiR-FLAG-TEV
Plasmid#105807PurposeFunctional studies using RNAi; rescue experiments; substituting protein for its different form. miRNA cassette with nuclear EGFP expression marker; your protein of interest with N-terminal FLAG tag.DepositorTypeEmpty backboneUseRNAi; Flp-in competentTagsFLAG-TEVExpressionMammalianAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28b(+)-SPN+IFS
Plasmid#83372PurposeExpresses SPN and IFS complex in E. coli cellDepositorInsertsSPN
IFS
TagsHexahistidine tagExpressionBacterialPromoterT7Available sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only