We narrowed to 168,459 results for: addgene
-
Plasmid#233007PurposeGalactose iduced expression of Gcn4 LVtoED W+GFPin yeastDepositorInsertGcn4 ILVtoED W+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
NOLC1 atgRNA pDY2250
Plasmid#219860Purposeattachment site pegRNA for human NOLC1DepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
NOLC1 nicking guide pDY2251
Plasmid#219861PurposeNicking sgRNA for NOLC1DepositorInsertNOLC1 nicking sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-WT-sgNT
Plasmid#222120PurposeEIF3D overexpression vector with non-targeting sgRNADepositorAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1387
Plasmid#229880PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses - Pmyo-2::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTRDepositorInsertPmyo-2::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTR
TagsGFP-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1392
Plasmid#229878PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses- Psnt-1::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTRDepositorInsertPsnt-1::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTR
TagsGFP-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-Emerald
Plasmid#225951PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-Emerald
Plasmid#225953PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-mCherry
Plasmid#225954PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGK58
Plasmid#228118PurposeExpress node 814 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 814, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKSEe401R
Plasmid#218532PurposeCRISPR/Cas9 genome editing vector pKSEe401R contains the maize codon-optimized Cas9 (zCas9) enhanced by the 5′-UTR fragment of OsMac3 and the pAtUBQ10-DsRED1-NOSt screening cassette in the backbone.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tensin-2 Y483E
Plasmid#201794PurposeExpresses Tensin-2 protein with Y483E mutation in MAC-Tag-C backboneDepositorInsertTensin-2 (Tns2 Mouse)
TagsBirA, HA, strepIIIExpressionBacterial and MammalianMutationmutation Y483EAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tensin-2 Y483F
Plasmid#201795PurposeExpresses Tensin-2 protein with Y483F mutation in MAC-Tag-C backboneDepositorInsertTensin-2 (Tns2 Mouse)
TagsBirA, HA, strepIIIExpressionBacterial and MammalianMutationmutation Y483FAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tensin-2 Y483A
Plasmid#201796PurposeExpresses Tensin-2 protein with Y483A mutation in MAC-Tag-C backboneDepositorInsertTensin-2 (Tns2 Mouse)
TagsBirA, HA, strepIIIExpressionBacterial and MammalianMutationmutation Y483AAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK65
Plasmid#228123PurposeExpress node 1795 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1550, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK59
Plasmid#228119PurposeExpress node 1429 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1429, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only