We narrowed to 10,692 results for: plasmids 101
-
Plasmid#224567PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.DepositorInsertmRFP1
UseCRISPRTagsMembrane localization signalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir144 EF1Alpha-puro-T2A-BFP
Plasmid#164791PurposeExpress miR-144 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Nanog-t2A-mCherry
Plasmid#127541PurposeExpresses the transactivation domain of mouse Nanog and mCherry via t2A linker.DepositorInsertNanog (Nanog Mouse)
ExpressionMammalianMutationCodes for the last 110 a.a of NanogPromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GA_CAG-rtTA-T2A-mTagBFP2
Plasmid#229797PurposeBxb1-GA donor plasmid for constitutive expression of reverse tetracycline transactivator (rtTA) and nuclear mTagBFP2DepositorInsertrtTA-T2A-mTagBFP2
UseSynthetic BiologyTagsNLSExpressionMammalianPromoterCAGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-myr-rsEGFP2- LDLR
Plasmid#213399Purposedouble floxed, myristoylation site (myr) and LDLR, fused to reversibly switchable EGFP rsEGFP2DepositorInsertrsEGFP2
UseAAVTagsC-terminal (Ct) cytoplasmic domains of low densit…ExpressionMammalianAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-SARS2-B.1.617.1
Plasmid#172319Purposeexpressing SARS-CoV-2 B.1.617.1 (kappa strain) spike protein for pseudovirus productionDepositorInsertSpike of B.1.617.1 strain (S SARS-CoV-2)
ExpressionMammalianMutationG142D, E154K, L452R, E484Q, D614G, P681R, Q1071H,…PromoterCMVAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_SARS2_omicron_BA.2.75
Plasmid#190674Purposeexpressing SARS-CoV-2 BA.2.75 spike protein for pseudovirus productionDepositorInsertSpike (S SARS-CoV-2)
ExpressionMammalianMutationK147E, W152R, F157L, I210V, G257S, D339H, G446S, …PromoterCMVAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475RG502R-AVI
Plasmid#160480PurposeExpresses SARS-CoV-2 RBD-L455RA475RG502R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475RG502R
TagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine, Alanine 475 to A…Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RG496R-AVI
Plasmid#160479PurposeExpresses SARS-CoV-2 RBD-L455RG496R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RG496R
TagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Glyci…Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475R-AVI
Plasmid#160478PurposeExpresses SARS-CoV-2 RBD-L455RA475R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475R
TagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Alani…Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hLin28B
Plasmid#26358DepositorAvailable SinceNov. 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_AKT1_WT
Plasmid#81764PurposeGateway Donor vector containing AKT1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_AKT1_WT
Plasmid#82294PurposeGateway Donor vector containing AKT1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_AKT1_p.L52R
Plasmid#81604PurposeGateway Donor vector containing AKT1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_AKT1_p.E267G
Plasmid#81561PurposeGateway Donor vector containing AKT1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8e-eVRQR-P2A-EGFP (HES1425)
Plasmid#242657PurposeCMV promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8e-SpCas9-VRQR(S55R)-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA, eVRQR mutations in SpCas…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-SpG-P2A-EGFP (BKS965)
Plasmid#242652PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpG(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpG-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, SpG mutations in SpCas9…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.20m-eVRQR-P2A-EGFP (LLH569)
Plasmid#242656PurposeCMV promoter expression plasmid for human codon optimized ABE8.20 A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.20m-VRQR-S55R-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA, eVRQR mutations in SpC…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only