We narrowed to 19,264 results for: tec
-
Plasmid#74796PurposeGateway cloning compatible binary vector for expression of gene by CaMV35S promoter.DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pKD184
Plasmid#90953PurposeExpresses ThsR under the PltetO-1 promoter, sfGFP under PphsA, and mCherry constitutivelyDepositorInsertsThiosulfate response regulator
Superfolder GFP
mCherry
ExpressionBacterialPromoterBba_J23114, PltetO-1, and PphsAAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDOC-GG
Plasmid#149377PurposeChassis plasmid for building mutagenesis cassettes by Golden Gate assembly to form a donor plasmid for recombineering by Gene DoctoringDepositorInsertsFragment containing a kanamycin resistance cassette
Fragment containing pMB1 origin of replication and an I-SceI recognition sequence
Fragment containing a lacZ⍺ expression cassette flanked by BsaI sites
Fragment containing an I-SceI recognition sequence
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFEndoNA
Plasmid#174724PurposeExpresses GFP-endoNA fusion protein for degradation of polysialic acid. The endoNA is a catalytically active endosialidase from bacteriophage PK1A.DepositorInsertGFP-endoNA fusion protein
TagsHistagExpressionBacterialPromoterT5Available SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGWB512
Plasmid#74854PurposeGateway cloning compatible binary vector for N-terminal fusion with FLAG (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MCP-M-MLV RT∆RNase H
Plasmid#213749PurposeFor circular RNA-mediated prime editor using MCP-M-MLV RT∆RNase H in HEK293T cellsDepositorInsertMCP-M-MLV RT∆RNase H
UseCRISPRTagsBPNLSExpressionMammalianPromoterCMVAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG (Lenti_sgRNA_EFS_GFP)
Plasmid#65656PurposeLentiviral introduction of sgRNA constitute expression linked with GFP marker into mammalian cell line.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter-driven sgRNA expression and EFS promo…Available SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHS1742
Plasmid#239838PurposeOrufIscB-KRK mammalian expressionDepositorInsertOrufIscB-KRK
TagsNucleoplasmin NLS-3xHA and SV40 NLSExpressionMammalianMutationInsertion of REC domain from NbaCas9-1 + E137K/E4…PromoterCMVAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB517
Plasmid#74859PurposeGateway cloning compatible binary vector for C-terminal fusion with 4xMyc (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-APOBEC1-YTH
Plasmid#131636PurposeExpresses APOBEC1 fused to the YTH domainDepositorAvailable SinceOct. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEdit
Plasmid#232355PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the tDepositorInsertsgRNA
UseCRISPRAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAF0689 Ef1a-Pa01_attB-BFP acceptor
Plasmid#193472PurposeAcceptor plasmid for 3 plasmid recombination assayDepositorInsertPa01_attB
ExpressionMammalianPromoterEf1aAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGWB414
Plasmid#74808PurposeGateway cloning compatible binary vector for C-terminal fusion with 3xHA (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVDL9.3
Plasmid#168299PurposeSecretion of polypeptides (nanobodies) in E. coli fused to C-terminal secretion signal of HlyADepositorInsertSegment of the hly operon, spanning the C-terminal part of hlyA, hlyB, and hlyD
ExpressionBacterialPromoterLacI-PlacAvailable SinceJune 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
3XFlagNICD1
Plasmid#20183DepositorInsertNotch 1 Intracellular Domain (Notch1 Mouse)
Tags3XFLAGExpressionMammalianMutationContains murine Notch 1 Intracellular Domain (Val…PromoterCMVAvailable SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNACRISPR_012-TetO-NLS-inactive-hfCas13d-NLS-WPRE-EFS-rtTA3-2A-Blast
Plasmid#228558PurposeExpresses inactive hfCas13d in mammalian cells for binding of target RNAs in combination with compatible crRNAs. Localized to the nucleusDepositorInsertdhfCas13d (N2V8)
UseLentiviralTagsNLS-HAMutationR239A/H244A/R858A/H863AAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAnc80L65AAP
Plasmid#92307PurposeAdeno-associated Viral Vector (AAV) capsid Anc80L65 in AAV2Rep expression construct with endogenous AAPDepositorInsertAncestral AAV Capsid Anc80L65AAP
UseAAV and Synthetic BiologyExpressionMammalianPromoterRep2Available SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pR26 CAG/GFP Asc
Plasmid#74285PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter, loxP flanked stop cassette and GFP, for cloning into AscIDepositorInsertRosa26 5-homology region
UseMouse TargetingAvailable SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-niCPE
Plasmid#213747PurposeFor circular RNA-mediated prime editor using LbCas12a-niCPE in HEK293T cellsDepositorInsertMCP-nLbCas12a-M-MLV RT∆RNase H
UseCRISPRTagsBPNLSExpressionMammalianMutationD156R, R1138A in LbCas12aPromoterCMVAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only