We narrowed to 9,230 results for: mel
-
Plasmid#112989PurposeExpresses fusion of GST and amino acids 244-458 of Drosophila SUURDepositorAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only
-
KHBD00717
Plasmid#39745DepositorAvailable SinceSept. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pGEX6P-1 BICC FL
Plasmid#112998PurposeFor protein expression and purification of full-length Drosophila BicCDepositorInsertfull length BicC (BicC Fly)
ExpressionBacterialAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDmAct5C::Cas9-2A-Neo
Plasmid#176679PurposeExpression of Drosophila codon optimized spCas9 under Drosophila Act5C promoterDepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprExpressionInsectMutationDrosophila codon optimizedPromoterD. melanogaster Act5CAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-white[coffee]
Plasmid#84006PurposeDonor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4DepositorInsertA 2,080 bp fragment of the white[coffee] allele (w Fly)
UseUnspecifiedMutationA GC-to-AA mutation that creates a G589E missense…Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
KHBD00476
Plasmid#39585DepositorAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMT-Pav-GFP
Plasmid#24286DepositorAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E K91N
Plasmid#110121PurposeExpresses Flag-tagged D. melanogaster Hel25E with K91N mutation that greatly reduces helicase activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationK91N mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E D193E
Plasmid#110120PurposeExpresses Flag-tagged D. melanogaster Hel25E with D193E mutation that greatly reduces ATP binding affinityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationD193E mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E MUT
Plasmid#110122PurposeExpresses Flag-tagged D. melanogaster Hel25E with 4 mutations that impact circRNA nuclear export activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutation4 mutations (KKLN motif changed to RSFS)PromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-tdT (AAV1)
Viral Prep#59171-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Syn-ChrimsonR-tdT (#59171). In addition to the viral particles, you will also receive purified pAAV-Syn-ChrimsonR-tdT plasmid DNA. Syn-driven ChrimsonR-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-tdT (AAV9)
Viral Prep#59171-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Syn-ChrimsonR-tdT (#59171). In addition to the viral particles, you will also receive purified pAAV-Syn-ChrimsonR-tdT plasmid DNA. Syn-driven ChrimsonR-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-GFP (AAV5)
Viral Prep#59170-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Syn-Chronos-GFP (#59170). In addition to the viral particles, you will also receive purified pAAV-Syn-Chronos-GFP plasmid DNA. Syn-driven Chronos-GFP expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFPAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-tdT (AAV5)
Viral Prep#59171-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Syn-ChrimsonR-tdT (#59171). In addition to the viral particles, you will also receive purified pAAV-Syn-ChrimsonR-tdT plasmid DNA. Syn-driven ChrimsonR-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-GFP (AAV1)
Viral Prep#59170-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Syn-Chronos-GFP (#59170). In addition to the viral particles, you will also receive purified pAAV-Syn-Chronos-GFP plasmid DNA. Syn-driven Chronos-GFP expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFPAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-GFP (AAV2)
Viral Prep#122100-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-EF1α1.1-GFP (#122100). In addition to the viral particles, you will also receive purified pAAV-EF1α1.1-GFP plasmid DNA. EF1a-driven expression of GFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1a(1.1kb short version)TagsGFPAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Donor_C_FH_Nbr
Plasmid#186662PurposeDonor plasmid to endogenously tag Nbr gene in Drosophila melanogaster at the C-terminal.DepositorInsertOSS Nbr C-terminal 3xFlag-3xHA Tag Donor Plasmid (Nbr Fly)
Tags3xFlag-3xHAExpressionInsectAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only