We narrowed to 7,330 results for: mag
-
Plasmid#118716PurposeThe no force control for the F40-based human desmoplakin II tension sensor serves to detect changes in FRET between YPet(short) and mCherry that are tension-independent.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherryExpressionMammalianMutationtruncation after aa1353PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TD)
Plasmid#61521PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TD mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TD mutation (see comments), Tom20, and m…ExpressionMammalianMutationTD mutation (see comments)PromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCitrine-DNAJC5 L115R
Plasmid#246735PurposeMammalian expression of human DNAJC5 L115R with a mCitrine (YFP) tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCitrineExpressionMammalianMutationL115RPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-DNAJC5
Plasmid#246730PurposeMammalian expression of human DNAJC5 wildtype with a mCerulean tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCeruleanExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-DNAJC5 L115R
Plasmid#246732PurposeMammalian expression of human DNAJC5 L115R with a mCerulean tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCeruleanExpressionMammalianMutationL115RPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-DNAJC5 delL116
Plasmid#246731PurposeMammalian expression of human DNAJC5 L116 deleted with a mCerulean tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCeruleanExpressionMammalianMutationdelL116PromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCitrine-DNAJC5
Plasmid#246733PurposeMammalian expression of human DNAJC5 wildtype with a mCitrine (YFP) tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCitrineExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-ActinVhh-sfGFP-P2A-HA-tdiRFP-caax (JDW 1532)
Plasmid#242606PurposeA CAGGS driven expression vector containing an actin nanobody fused to sfGFP to label actin followed by a HA tagged tdiRFP fused to a caax tag to label the cell membrane.DepositorInsertActin Vhh-sfGFP-P2A-HA-tdiRFP-caax
ExpressionMammalianPromoterCAGGSAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-D1315-1467-SFB
Plasmid#247919PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2 D1315-146DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 1315-1467Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-D87-291-SFB
Plasmid#247914PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2 D87-29DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 87-291Available SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5
Plasmid#246740PurposeMammalian expression of human DNAJC5 with L116 deleted, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF-1α-Venus-Nup107-FRT
Plasmid#247344PurposeExpresses Venus-NUP107 under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-dCas9(sa)-VP64-AAV
Plasmid#213035PurposedCas9-VP64 expressed under control of TREDepositorInsertdCas9
UseAAV and CRISPRTagsNLS and NLS-VP64PromoterTRE, miniCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_4
Plasmid#242899PurposePiggyBac cargo vector with HNRNPK sgRNA 4 for dox-inducible knockdownDepositorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-hs_UbiC-pro (JDW 1461)
Plasmid#242547PurposeEnhancer/Promoter: Gateway 5' entry vector containing human Ubc promoter (-1225 to -6)DepositorInsertUbiquitin / Ubc promoter (UBC Human)
UseGateway subcloningAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_1
Plasmid#242897PurposePiggyBac cargo vector with HNRNPK sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_3
Plasmid#242898PurposePiggyBac cargo vector with HNRNPK sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only