We narrowed to 14,273 results for: cas9
-
Plasmid#165599PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFH6_new
Plasmid#105866Purposemore efficient version of pFH6; Subcloning of any sgRNA via BbsI siteDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR and Synthetic Biology; SubcloningExpressionPlantAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330A_FokI-1x2
Plasmid#63602PurposeExpresses FokI-dCas9 and gRNADepositorInsertFokI-dCas9
UseCRISPRExpressionMammalianPromoterCBhAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB3042(gRNA X-4)
Plasmid#73284PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJAT10
Plasmid#204293PurposeFor marking CRISPR HDR integrant with DsRed expressed in flight muscles.DepositorInsertMHC-DsRed
UseCRISPRPromoterMHCAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Nme2sgRNA_pLKO
Plasmid#119926PurposeNme2Cas9 U6-driven sgRNA cassetteDepositorInsertNmeCas9 sgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135A
Plasmid#69277PurposeGolden Gate entry vector; 5th gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141C
Plasmid#69292PurposeGateway entry vector; single gRNA under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
th-P2A-Gal4 donor
Plasmid#65563PurposeIntron targeting-mediated Gal4 knockin at the zebrafish th locus.DepositorAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB6677
Plasmid#106155PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6632, integration into Yarrowia lipolytica chromosomal location IntE_1, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBLO 4.01
Plasmid#121495Purposeengineered Mu transposonDepositorTypeEmpty backboneExpressionBacterialPromoterp15AAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMZ284
Plasmid#52225PurposeExpression of sgRNA precursor targeted against ade6+DepositorInsertrrk1-sgRNA
UseCRISPRExpressionYeastPromoterrrk1Available SinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’VIM-eGFP-KI
Plasmid#170547PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP flanked by homology arms for VIMDepositorInsertsLeft Homology arm for VIM knockin
Right Homology arm for VIM knockin
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMiniT:SEP-GluN1 TKIT donor
Plasmid#169427PurposeDonor DNA for TKIT knockin of SEP to NR1 in mouseDepositorInsertSuper ecliptic pHluorin (SEP)
UseCRISPRExpressionMammalianAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMiniT:SEP-GluA1 TKIT donor
Plasmid#169418PurposeDonor DNA for TKIT knockin of SEP to GluA1 in mouseDepositorInsertSuper ecliptic pHluorin (SEP)
UseCRISPRExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
DHFR-PP7-VP64_T2A_GFP
Plasmid#86167PurposeExpresses PP7-VP64 fused to DHFR domain on N-terminus in mammalian cellsDepositorInsertDHFR-PP7-VP64_T2A_GFP
UseCRISPR and LentiviralTagsDestabilized domain (N-terminus version) of E.col…ExpressionMammalianPromoterEF1aAvailable SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv2
Plasmid#221139PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 2 without sgRNA construct. Expresses 3xF-BE4-PpAPOBEC1(H122A).DepositorInsert3xF-PpAPOBEC1(H122A)-Cas9n-UGI-UGI (BE4-PpAPOBEC1(H122A))
UseCRISPRTags3xFLAGExpressionBacterialPromoterlacIq-PtacAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only