We narrowed to 5,969 results for: actin
-
Plasmid#221597PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with RVEP4A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CD8a-AA347-363-KRN-3A-GFP
Plasmid#221598PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with KRN-3A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available sinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/MALAT1[C8351G] (pAVA3169)
Plasmid#239346PurposeExpresses full-length, driven by its own promoter MALAT1 with stability-compromised ENE(C8351G) and an 11-nt insertion (cgctcgacgta).DepositorInsert10,843 bp of MALAT1 of genomic locus amplified from genomic DNA of Hela cells (MALAT1 Human)
ExpressionMammalianMutationAn 11-nt insertion (cgctcgacgta) and stability-co…Available sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmCYFIP1_T
Plasmid#147585PurposeInsect Expression of DmCYFIP1DepositorInsertDmCYFIP1 (Sra-1 Fly)
ExpressionInsectMutation5 silent and one non silent A146V mutations compa…Available sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmCYFIP1_T
Plasmid#147578PurposeInsect Expression of DmCYFIP1DepositorInsertDmCYFIP1 (Sra-1 Fly)
ExpressionInsectMutation5 silent and one non silent A146V mutations compa…Available sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-delMBR-pEGFP-C1
Plasmid#177432PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with its membrane binding region (MBR) deleted (Bik(1-136)). Compare to full length Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationBik MBR removed (after position 136)PromoterCMVAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLG-Nde-Acc
Plasmid#33150DepositorPublicationInsertRP51A-synthetic minimal intron (RPS17A Budding Yeast)
TagsLacZExpressionYeastMutationAccI site in intron was cut/filled/ligated to cha…Available sinceDec. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmCYFIP1-4xmut_T
Plasmid#147586PurposeInsect Expression of DmCYFIP1-4xmutDepositorInsertDmCYFIP1-4xmut (Sra-1 Fly)
ExpressionInsectMutation5 silent and one non silent A146V mutations compa…Available sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmCYFIP1-K743E_T
Plasmid#147587PurposeInsect Expression of DmCYFIP1-K743EDepositorInsertDmCYFIP1-K743E (Sra-1 Fly)
ExpressionInsectMutation5 silent and one non silent A146V mutations compa…Available sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBac(EFA-Brainbow; 3xP3-DsRed)
Plasmid#256611PurposeBrainbow for Tribolium castaneum (under EFA ubiquitous promoter)DepositorPublicationInsertsBrainbow 1.1M (with mutated Kusabira) expressed by EFA cis-regulatory element
3xP3-DsRed as transformation marker
UsePiggybac transposon in plasmid backboneMutationcoding sequence of Kusabira orange fluorescent pr…Available sinceJune 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBac(EFA-Brainbow; 3xP3-EGFP)
Plasmid#256610PurposeBrainbow for Tribolium castaneum (under EFA ubiquitous promoter)DepositorPublicationInsertsBrainbow 1.1M (with mutated Kusabira) expressed by EFA cis-regulatory element
3xP3-EGFP as transformation marker
UsePiggybac transposon in plasmid backboneMutationcoding sequence of Kusabira orange fluorescent pr…Available sinceJune 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1-AtRBX1-T7-HsSKP1-T7-AtCUL1-S
Plasmid#228944PurposeExpression AtRBX1-T7, HsSKP1-T7 and AtCUL1-S in in bacterial cellsDepositorTagsS-Tag and T7ExpressionBacterialAvailable sinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-del72-136-pEGFP-C3
Plasmid#191411PurposeTransfection of this plasmid will express "VBik-d72-136" (Venus fused to the N-terminus of the BH3-only protein, Bik that has amino acids 72-136 deleted).DepositorInsertBcl-2-interacting killer (BIK Human)
TagsVenusExpressionMammalianMutationwith deletion of amino acids 72-136 (del72-136) i…PromoterCMVAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Antibody#254655-rAbPurposeAnti-CNTN2 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse CNTN2. Does not cross-react with other CNTNs.DepositorPublicationRecommended applicationsFlow Cytometry, Immunocytochemistry, and ImmunohistochemistryReactivityHuman and MouseSource speciesRabbitIsotypeIgGTrial sizeNot available to purchaseAvailable sinceMay 27, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits