We narrowed to 8,219 results for: Lif
-
Viral Prep#218871-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-GFAP-iGABASnFR2-WPRE (#218871). In addition to the viral particles, you will also receive purified pGP-AAV-GFAP-iGABASnFR2-WPRE plasmid DNA. GFAP-driven expression of the improved GABA sensor iGABASnFR2 (positive change in fluorescence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pGP-AAV-GFAP-iGABASnFR2-WPRE (AAV1)
Viral Prep#218871-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-GFAP-iGABASnFR2-WPRE (#218871). In addition to the viral particles, you will also receive purified pGP-AAV-GFAP-iGABASnFR2-WPRE plasmid DNA. GFAP-driven expression of the improved GABA sensor iGABASnFR2 (positive change in fluorescence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (AAV Retrograde)
Viral Prep#100853-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (#100853). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 plasmid DNA. Synapsin-driven, Cre-dependent GECO1a calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-iGABASnFR2(no bind)-WPRE (AAV1)
Viral Prep#218876-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-iGABASnFR2(no bind)-WPRE (#218876). In addition to the viral particles, you will also receive purified pGP-AAV-syn-iGABASnFR2(no bind)-WPRE plasmid DNA. Syn-driven expression of the improved GABA sensor control iGABASnFR2(no bind) (no change in fluorescence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-iGABASnFR2(no bind)-WPRE (AAV5)
Viral Prep#218876-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-syn-iGABASnFR2(no bind)-WPRE (#218876). In addition to the viral particles, you will also receive purified pGP-AAV-syn-iGABASnFR2(no bind)-WPRE plasmid DNA. Syn-driven expression of the improved GABA sensor control iGABASnFR2(no bind) (no change in fluorescence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE (AAV5)
Viral Prep#218873-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE (#218873). In addition to the viral particles, you will also receive purified pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE plasmid DNA. GFAP-driven expression of the improved GABA sensor control iGABASnFR2(no bind) (no change in fluorescence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE (AAV1)
Viral Prep#218873-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE (#218873). In addition to the viral particles, you will also receive purified pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE plasmid DNA. GFAP-driven expression of the improved GABA sensor control iGABASnFR2(no bind) (no change in fluorescence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-H
Plasmid#66189Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), hygro selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAGT9054
Plasmid#219430PurposeTranscriptional unit (MoClo-position 2): 2x35Ss_Omega enhancer_PapE-4LF2-N-SpCas9i-N_tOCSDepositorInsertLB_2x35Ss-omega enhancer:PapE-4xLF2-NLS-SpCas9i-NLS:tOCS_RB (Position 2)
UseCRISPR; Moclo compatible level 1 module (position…TagsPapE-4LF2ExpressionPlantAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – H2B-GFP-N – loxP – mScarlet
Plasmid#219565Purpose3` circularization cassette to induce Cre-mediated circularization of a genomic region flanked by loxP sites with H2B-GFP reconstitution and mScarlet expression from the chromosomeDepositorInsertHygroR_2A_H2B-GFP-N_loxP_mScarlet
UseUnspecifiedPromoterEF-1aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – GFP-N – loxP – mScarlet
Plasmid#219564Purpose3` circularization cassette.To induce Cre-mediated circularization or inversion of a genomic region with concomitant GFP reconstitution and mScarlet expression from the chromosomeDepositorInsert3` CC: Hygro – GFP-N – loxP – mScarlet
UseUnspecifiedPromoterEF1-aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 KBTBD4 WT
Plasmid#184627PurposeMammalian expression vector with N-terminal 3xFlag for KBTBD4 WT expression in mammalian cellsDepositorInsertN-terminal 3xFlag tagged KBTBD4 WT (KBTBD4 Human)
ExpressionMammalianMutationno mutationPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-B
Plasmid#66190Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), basta selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/HaloTag7-Geminin(1/110)_P2A_HaloTag9-Cdt(1-110)Cy-
Plasmid#169338PurposeExpression of the LT-Fucci(CA) in mammalian cellsDepositorTagsHaloTag7-Geminin(1/110) and HaloTag9-Cdt(1-110)Cy…ExpressionMammalianMutationHaloTag9 = HaloTag7-Q165H-P174RAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK FKBP12(F36V)-OGT (Neo)
Plasmid#154294PurposeLentiviral vector encoding FKBP12(F36V)-2xHA-OGT (Neomycin resistant) off PGK promoterDepositorInsertO-GlcNAc Transferase (OGT Human)
UseLentiviralTags2x HA and FKBP12(F36V)ExpressionMammalianPromoterPGKAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-N
Plasmid#66191Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), Neo selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3XHA-p53
Plasmid#196267PurposeMammalian expression of 3xHA tagged wild-type p53DepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-eGFP-hcGAS
Plasmid#108674PurposeFor production of retrovirus and transduction of mammalian cells, allowing expression of N-terminally eGFP-tagged human cGASDepositorAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
M43: pHR-SFFVp-iLID::EGFP::FTH1
Plasmid#122149PurposeSelf-assebled 24-mer tagged with iLID, and EGFP. Upon blue-light activation can bind up to 24 SspB-modified proteins.DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only