We narrowed to 7,397 results for: mcherry
-
Plasmid#27135DepositorUseLentiviralTagseGFP and mCherryExpressionMammalianMutationTyrosines in ITAMS 1-3 mutated to phenylalanines …Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only
-
-
pAC8_MF-p10-mCh PH-mCh (VE5625)
Plasmid#139769PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an mCherry cDNA under each promoter.DepositorInsertmCherry fluorescent protein
ExpressionInsectPromoterPH or p10Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC101
Plasmid#62335PurposesgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC73
Plasmid#62341PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSN33
Plasmid#100118Purposeexpresses a chimeric KLF4-repressor fusionDepositorUseLentiviralExpressionMammalianAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEnt R3L2 TetO(sh) mCh-Rs1-2
Plasmid#24417PurposeHuman 5HT4B receptor with D100A mutation, generating the RASSL Rs1. Construct expresses both mCherry and Rs1 via a P2A ribosomal skip sequence. Plasmid also known as pEntR3L2 TetO-mCh-Rs1.DepositorInsertRs1
UseGateway CloningTagsFLAG and mCherry-P2AMutationD100APromotershort TetO, miniCMVAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H334
Plasmid#245738PurposeFLIM biosensor for real-time cAMP monitoring, no nuclear membrane affinity, with nuclear photoactivatable mCherry. mT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST)-2A-PAmCherry-3xNLSDepositorInsertmTurq2del_EPACdDEPCD_Q270E_L777A_K778A_tdblcp173V(st)
TagsT2A, Photoactivatable mCherry-3xNLSExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterEF-1aAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H250
Plasmid#245739PurposeFLIM biosensor for real-time cAMP monitoring, with nuclear photoactivatable mCherry to label nuclei of selected cells. mT2Del_EPACdDEPCD_Q270E_tdBlackcp173Venus(ST)-2A-PAmCherry-HNSDepositorInsertmTurq2del_EPACdDEPCD_Q270E_tdblcp173V(st)
TagsT2A, Photoactivatable mCherry-HNSExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …Available SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCambia2300-Aar1-BCPp-NLS-2xmCH_STR1p-cYFP-STR1g_STR2p-nYFP-STR2g
Plasmid#254407PurposeBiFC plasmid with cYFP-STR and nYFP-STR2 expressed from their native promoters and MtBCP1-NLS- 2X mCherry.DepositorInsertsSTR promoter-nYFP-STR_STR2 promoter-cYFP-STR2
M. truncatula BCP1 promoter - NLS-2X-mCherry
ExpressionPlantPromoterMtBCP1 promoter and STR promoterAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT7-V5H6.MCh.Puro
Plasmid#209946PurposeIn mammalian cells expresses TP fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6-V5H6.MCh.Puro
Plasmid#209944PurposeIn mammalian cells expresses TP fused to a CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6L-V5H6.MCh.Puro
Plasmid#209945PurposeIn mammalian cells expresses TP fused to a CNOT6L with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHPHS926
Plasmid#228237PurposeBxb1 attB_GA mCherry-T2A-puro, Dox-inducible β-globin NMD reporter with premature termination codon for integration into Bxb1 attP_GA landing padDepositorInsertsmCherry
Beta globin
Tags3xFLAG, HA, and PuroRExpressionMammalianMutationPTC39PromoterTRE3GV and noneAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHPHS927
Plasmid#228238PurposeBxb1 attB_GA mCherry-T2A-puro, Dox-inducible β-globin reporter for integration into Bxb1 attP_GA landing padDepositorInsertsmCherry
Beta globin
Tags3xFLAG, HA, and PuroRExpressionMammalianPromoterTRE3GV and noneAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-855
Plasmid#218013PurposemCherry fluorescent proteinDepositorInsertmCherry
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSR13
Plasmid#69155Purposeread-outloxN mCherry to GFP switch, with swsn-1 promoter, gene (partially cDNA) and UTR, for integration on on ttTi5605, Mos Chr IIDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0, codon-optimzed index 1.…Promoterrps-27 and swsn-1Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
AV0-BWS-2.0-mC-G-CL3B
Plasmid#124975Purposeevaluate autophagyDepositorInsertmCherry-GFP-LC3B
UseAAVPromoterEF1-alphaAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p41Nat MagicFluor
Plasmid#58563Purposep41Nat carrying both mating type markers buffered by the Cyc1 terminatorDepositorInsertSte2p-Citrine, Cyc1 term, Ste3p-mCherry
ExpressionYeastAvailable SinceNov. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
p41Neo MagicFluor
Plasmid#58564Purposep41Neo carrying both mating type markers buffered by the Cyc1 terminatorDepositorInsertSte2p-Citrine, Cyc1 term, Ste3p-mCherry
ExpressionYeastAvailable SinceNov. 24, 2014AvailabilityAcademic Institutions and Nonprofits only