We narrowed to 10,063 results for: CAG
-
Plasmid#77990Purpose3rd generation lentiviral gRNA plasmid targeting human EXOSC10DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pX459-CTNNB1-S45
Plasmid#164587PurposeExpresses a gRNA that overlaps the S45 codon of human CTNNB1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCTNNB1 gRNA (CTNNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
B52 + SPRTN sgSTOP
Plasmid#100709PurposeB52 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
TGFBR2 gRNA (BRDN0001149310)
Plasmid#77469Purpose3rd generation lentiviral gRNA plasmid targeting human TGFBR2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3CA gRNA (BRDN0001148028)
Plasmid#77418Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CADepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 gRNA (BRDN0001148071)
Plasmid#76182Purpose3rd generation lentiviral gRNA plasmid targeting human FGFR2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc Fstl1
Plasmid#13497DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFstl1 (Fstl1 Mouse)
UseLuciferaseMutationcontains 3 tandem copies of the following sequenc…Available sinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-neo-sgTAF12(human)#4.4
Plasmid#105590Purposelentivirally express gRNA targeting human TAF12 HFD with GFP marker and neo resistanceDepositorPublicationInsertgRNA targeting human TAF12 HFD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR1 gRNA (BRDN0001146517)
Plasmid#76069Purpose3rd generation lentiviral gRNA plasmid targeting human FGFR1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KB1 gRNA (BRDN0001148368)
Plasmid#75614Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KB1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUbC-EGFP-sgRNA.FOXA1/A2/A3_CRISPRi
Plasmid#216166PurposeExpress the gRNAs for the human FOXA1/A2/A3-CRISPRiDepositorInsertUseLentiviralTagsEGFPPromoterphU6, ph7SK, phH1, pmU6Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmyc-GFP-TNRC6A-NLS/NES-mut
Plasmid#42002DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTNRC6A (TNRC6A Human)
TagsEGFP and MycExpressionMammalianMutationR930A, R931A, R932A, R934A, F951A, F955A, I958A, …PromoterCMVAvailable sinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_HH-EMX1 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
Plasmid#176459PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting EMX1 driven by EF1alpha promoter and and EGFP(L138S)-P2A-mCherry driven by CMVDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHH-EMX1 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable sinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmyc-GFP-TNRC6A-del.GW-I+II+III-NES-mut
Plasmid#42040DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTNRC6A (TNRC6A Human)
TagsEGFP and MycExpressionMammalianMutationdeleted aa457-532, aa716-772 and aa804-924, F951A…PromoterCMVAvailable sinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGRNA2II_LacZT1
Plasmid#247079PurposeL-arabinose inducible crRNA of type I-E CRISPR cas (Escherichia coli K-12). encoding 105 nt spacer which targets Ecoli LacZ T1 siteDepositorInserttype I-E CRISPR cas crRNA
UseCRISPRExpressionBacterialAvailable sinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only