We narrowed to 9,564 results for: sas
-
Plasmid#48361PurposeTargets beta-Tubulin for Cre-lox mediated knockout in T. brucei, Hygromycin selectableDepositorInsertPartial beta-TUB followed by 5' ALD UTR-loxP-SAS-HYG-loxP-3' ALD UTR
UseCre/Lox; Knockout in t. bruceiAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBS_KS_attB2_SA(2)_T2AGAL80
Plasmid#125219PurposeArtificial phase 2 exon to include a spliced T2A-GAL80 effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGAL80
UseOtherTagsT2AAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHJ33
Plasmid#48362PurposeTargets beta-Tubulin for Cre-lox mediated knockout in T. brucei, Puromycin selectableDepositorInsertPartial beta-TUB followed by 5' ALD UTR-loxP-SAS-PUR-loxP-3' ALD UTR
UseCre/Lox; Knockout in t. bruceiAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-MerCreMer-hygro
Plasmid#188982PurposeRetroviral expression of tamoxifen-inducible Cre recombinaseDepositorInsertTamoxifen-inducible Cre recombinase
UseCre/Lox and RetroviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-sgTrp53-sgAtrx-EFS-Cre
Plasmid#189977PurposeExpresses Cre cDNA and sgRNAs targeting murine Trp53 and AtrxDepositorInsertsgTrp53, sgAtrx, Cre recombinase
UseAAV, Cre/Lox, and Mouse TargetingAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
CL20_MSCV-NUP98-ires-GFP
Plasmid#237481PurposeExpress NUP98 in bicistronic retroviral vectorDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CCLMPC_HA-NUP98
Plasmid#237482PurposeExpress HA-tagged NUP98 in dual promoter lentiviral vectorDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLBCX-Large-T-antigenK1 mutant
Plasmid#189978PurposeRetroviral vector used to immortalize human cellsDepositorInsertLarge-T-antigenK1 mutant
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
USO hisB- pyrF- rpoZ-
Bacterial Strain#18049DepositorBacterial ResistanceTetracyclineAvailable SinceJuly 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLAG-SBP-STAG2 (WT)
Plasmid#73963PurposeSTAG2 cDNA (CCDS43990) wild typeDepositorAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2292
Plasmid#70707PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA_tdtomato_reporter_1_SA-2x
Plasmid#79369PurposeAssays activity of transcriptional activators fused to SA Cas9DepositorInserttdtomato
UseCRISPRExpressionMammalianAvailable SinceAug. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2253
Plasmid#70704PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTK234_051
Plasmid#123919PurposeEncodes the saCas9 UAS (miniCMV core) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertpUAS sgRNA (Sa)
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V3 (Concentrated Lentiviral Prep)
Viral Prep#115645-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V3 (#115645). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V3 plasmid DNA. Ready-to-use lentiviral particles carrying version 3 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.DepositorPromoterMinimal CMVTagsEGFPAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V2 (Concentrated Lentiviral Prep)
Viral Prep#115644-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V2 (#115644). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V2 plasmid DNA. Ready-to-use lentiviral particles carrying version 2 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.DepositorPromoterMinimal CMVTagsEGFPAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pONSY-CoH2B:Venus
Plasmid#111877PurposeThis plasmid expresses Venus fluorescent protein fused to endogenous Histone H2B (H2B) gene of Capsaspora (CAOG_01818). It can be used to transfect Capsaspora cells and visualize nucleus in vivo.DepositorInsertCapsaspora Histone H2B (CoH2B) fused to Venus
UseCapsaspora owczarzakiTagsVenusPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-multi-v1 barcode library
Pooled Library#206045PurposeThe CellTag multi library of barcodes can be used to clonally label cells with DNA barcodes. These barcodes can be profiled directly with single-cell RNA and ATAC sequencing, to allow clonal trackingDepositorUseLentiviralAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-U6gRNA(lib)-PGKpuroT2ABFP library
Pooled Library#104861PurposeRetroviral library containing gRNAs from the Yusa lab Mouse improved genome-wide library v2.DepositorAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only