We narrowed to 22,205 results for: nar;
-
Plasmid#163100PurposeExpression of mEos3.2 in eukaryotes to stain the nuclear compartmentDepositorInsertNLS_mEos3.2_NLS
UseEukaryotic expressionTagsExpressionMammalianMutationPromoterCMV promoter; T7 promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
LG002: pMAGIC (L1-R5) mU6::xCas9(3.7) gRNA scaffold
Plasmid#121816PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LG002: pMAGIC (L1-R5) mU6::xCas9(3.7) gRNA scaffold
Plasmid#121816PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[3]-C (LEU2)
Plasmid#177796PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[3] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[3]ExpressionYeastMutationPromoterADH1Available sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[3]-C (LEU2)
Plasmid#177796PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[3] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[3]ExpressionYeastMutationPromoterADH1Available sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-C (TRP1)
Plasmid#177795PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[1,2]ExpressionYeastMutationPromoterADH1Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-C (TRP1)
Plasmid#177795PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[1,2]ExpressionYeastMutationPromoterADH1Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 d6BD
Plasmid#68832PurposeExpresses c-myc-tagged human RAD18 deleting hRAD6 binding domainDepositorInsertc-myc tagged human RAD18 deleting hRAD6 binding domain (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 d6BD
Plasmid#68832PurposeExpresses c-myc-tagged human RAD18 deleting hRAD6 binding domainDepositorInsertc-myc tagged human RAD18 deleting hRAD6 binding domain (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTE4565
Plasmid#88903PurposeExpresses inactive/dead, humanized MbCpf1 nucleaseDepositorInserthMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianMutationPromoterCMVAvailable sinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE4565
Plasmid#88903PurposeExpresses inactive/dead, humanized MbCpf1 nucleaseDepositorInserthMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianMutationPromoterCMVAvailable sinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 C207F
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 C207F
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28b-API5
Plasmid#157655PurposeExpresses API5 in E.coli cellDepositorInsertApoptosis inhibitor 5 (API5 Human)
UseTagsHis tagExpressionBacterialMutationPromoterAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28b-API5
Plasmid#157655PurposeExpresses API5 in E.coli cellDepositorInsertApoptosis inhibitor 5 (API5 Human)
UseTagsHis tagExpressionBacterialMutationPromoterAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
IR904: pMVP (L3-L2) pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121799PurposepMVP L3-L2 entry plasmid, contains polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds CMV-driven GFP-P2A-TETa downstream of gene of interest.DepositorInsertpolyA + CMV::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IR904: pMVP (L3-L2) pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121799PurposepMVP L3-L2 entry plasmid, contains polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds CMV-driven GFP-P2A-TETa downstream of gene of interest.DepositorInsertpolyA + CMV::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmiR-96 cluster promoter
Plasmid#62517PurposemicroRNA 183-96-182 cluster promoter luciferase plasmidDepositorInsertpromoter of microRNA-183-96-182 cluster
UseTagsRenSP (optimized renilla luciferase gene)ExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only