We narrowed to 10,063 results for: CAG
-
Plasmid#222241PurposeExpress FLAG tagged DDX53 in mammalian cellsDepositorAvailable sinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pLKO-Tet-On shYap1-4
Plasmid#193670PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-1
Plasmid#164865PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-1
UseCRISPRExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPN287
Plasmid#91670PurposeExpress sgRNA targeting human SLC45A1DepositorAvailable sinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS2050
Plasmid#49135PurposeAAV plasmid with CAGGS promoter driving expression of EmGFP.DepositorInsertssAAV-CAGGS-emGFP
UseAAVExpressionMammalianPromoterCAGGSAvailable sinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
CasRx gRNA targeting EZH2
Plasmid#219655PurposehU6-driven expression of CasRx guide RNA targeting EZH2. 5' processed DR followed by EZH2 guide.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCasRx gRNA targeting EZH2
UseCRISPRAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-1
Plasmid#180391PurposeProducing AAV that encodes mouse Stk16 shRNA-1 with miR-E backboneDepositorAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AmsgRNA
Plasmid#121956PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAmCas12b single chimeric gRNA
ExpressionMammalianAvailable sinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN060
Plasmid#91593PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable sinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-Myocardin
Plasmid#100769PurposeLentiviral expression of shRNA targeting MYOCDDepositorInsertLenti-sh-Myocardin
UseLentiviralExpressionMammalianPromoterhU6Available sinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
shCDK6(1)
Plasmid#73552PurposeshRNA(1) against CDK6DepositorInsertshRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable sinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
ipUSEPR-sg-Hs-PHGDH-1
Plasmid#188675PurposesgRNADepositorAvailable sinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-dADAM17 (#1)
Plasmid#177259PurposeA knockout vector for the dog Adam17DepositorInsertA gRNA targeting the dog Adam17 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHK352.3
Plasmid#235473PurposeMessage phagemid carrying sgRNA3 (prom. J23110, backbone RSF1030)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA3
UseSynthetic BiologyAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF0887
Plasmid#142703PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORE303N_CEN12RRFuzzy3MYB
Plasmid#194441PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout: CEN12, RR, and Fuzzy3MYBDepositorInsertgRNA array targeting CEN1, RR, Fuzzy3MYB
UseCRISPRExpressionPlantPromoterMtU6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGG184
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only