We narrowed to 11,504 results for: ENA
-
Plasmid#204476Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B R153X mutantDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pLenti HsATP10B_V748L
Plasmid#204477Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B V748L mutantDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B_G671R/N865K
Plasmid#204478Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B G671R/N865K mutantsDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B_E993A
Plasmid#204479Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B E993A mutantDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B_I1038T
Plasmid#204480Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B I1038T mutantDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-mSox2C17
Plasmid#206369PurposeExpresses mouse SOX2-C17 in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
1BR9-AtWUSSTOP-Δα3
Plasmid#202056PurposeE. coli expression vector for N-ter GFP11 tagged Arabidopsis thaliana WUSCHEL with the third helix in the homeodomain deleted.DepositorInsertAtWUS E. Coli Codon Optimized, third helix of homeodomain deleted (WUS Mustard Weed)
Tags6xHis and GFP11ExpressionBacterialMutationthird helix of homeodomain deleted (AA82-102)PromoterT7 PromoterAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
psicheck2-B4GALT3mut
Plasmid#203602PurposeReporter plasmid carrying B4GALT3 3'UTR with mutated miR27b target sequences.DepositorInsertbeta-1,4-galactosyltransferase 3 (B4GALT3 Human)
UseLuciferaseExpressionMammalianMutationSeed sequences in miR-27b target sequences were m…Available SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
psicheck2-MAIP1mut
Plasmid#203604PurposeReporter plasmid carrying MAIP1 3'UTR with mutated miR27b target sequencesDepositorInsertmatrix AAA peptidase interacting protein 1 (MAIP1 Human)
UseLuciferaseExpressionMammalianMutationmiR-27b target sequences in the 3'UTR was mu…PromoterSV40Available SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Palpha2
Plasmid#204441PurposeMammalian expression plasmid of GFP-tagged hOpa1 isoform 1 mutant protein.DepositorInserthOpa1 isoform 1 (OPA1 Human)
TagsEGFPExpressionMammalianMutationW771A K772A K773A R774A W775A L776A Y777A W778A K…PromoterCMVAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #1
Plasmid#198759Purposeconditional knockdown of FDPSDepositorInsertshFDPS #1 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-S13AI15AD30KT35A_E
Plasmid#146217PurposeInsect Expression of DmTral-S13AI15AD30KT35ADepositorInsertDmTral-S13AI15AD30KT35A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-S13AI15AR21A_E
Plasmid#146218PurposeInsect Expression of DmTral-S13AI15AR21ADepositorInsertDmTral-S13AI15AR21A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R21A_E
Plasmid#146220PurposeInsect Expression of DmTral-R21ADepositorInsertDmTral-R21A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1333NC
Plasmid#186202PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1333N of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1333C of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
KCC2 scFv [N1/12]
Plasmid#190520PurposeMammalian Expression of KCC2 scFV. Derived from hybridoma N1/12.DepositorInsertKCC2 (Rattus norvegicus) recombinant scFV (Slc12a5 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1333CN
Plasmid#186201PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1333C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1333B of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-V5His6_B
Plasmid#145996PurposeInsect Expression of DmTral-LSmDepositorInsertDmTral-LSm (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only