We narrowed to 14,241 results for: Cre
-
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXD023 - pLKO-EF1a-Puro-P2A-FLuc-WPRE
Plasmid#192203PurposeLenti-PL(Puro-Luciferase)DepositorInsertLenti-PL(Puro-Luciferase)
UseLentiviral; Mammalian expressionMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-NES
Plasmid#171006PurposeHiLITR protease with C-terminal NNES (Cytoplasmic)DepositorInsertEGFP-uTEV1-NES
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B GG
Plasmid#89451PurposeExpression of GFP-tagged human Rab27B GG in mammalian cellsDepositorInserthuman Rab27B GG (RAB27B Human)
TagseGFPExpressionMammalianMutationGG (geranyl geranyl site is mutated)PromoterCMVAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCLHCX-mPM20D1-flag
Plasmid#84566Purposemouse PM20D1, C-term flag and his tags, in mammalian retroviral expression plasmid. Amp/Hygro selectionDepositorInsertpeptidase M20 domain containing 1 (Pm20d1 Mouse)
UseRetroviralTags6xHis and FlagExpressionMammalianPromoterCMVAvailable SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG306-GPD-AVT1 chr I
Plasmid#41898PurposeYeast expression of AVT1.DepositorAvailable SinceFeb. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pD2529-CAG-b3
Plasmid#189797PurposeExpression of full length human integrin beta 3DepositorAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-RUNX3-T2A-PuroR
Plasmid#162349PurposeLentiviral expression of RUNX3 under the control of the TetON promoterDepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Thr58Ala_P2A_Hygro_Barcode
Plasmid#120513PurposeBarcoded lentiviral vector to express MYC Thr58Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Thr58Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Threonine to Alanine at a…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flrt3-Fc-His
Plasmid#72075PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 Flag-Smad2 (1-456)
Plasmid#14958DepositorInsertSmad2 (SMAD2 Human)
TagsFlagExpressionMammalianMutationAmino acids 1-456 (tail deletion)PromoterCMVAvailable SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
eGFP-KCC2
Plasmid#104075Purposeexpresses rat KCC2 (b isoform) with eGFP tag at the N-terminus of KCC2DepositorInsertKCC2 (b isoform) (Slc12a5 Rat)
TagsEGFPExpressionMammalianMutationEcoR1 site in rat KCC2 was removed by silent muta…PromoterCMVAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-Fc-His
Plasmid#72175PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pECE-M2-AMPKalpha2 M93G
Plasmid#31653DepositorInsertprotein kinase, AMP-activated, alpha 2 catalytic subunit M93G (PRKAA2 Human)
TagsM2ExpressionMammalianMutationchanged Methionine 93 to GlycineAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
E pCMV-CFPLoxP-YFPatt
Plasmid#24509DepositorArticleInsertECFP, EYFP
TagsECFP and EYFPExpressionMammalianAvailable SinceMay 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
GST-SEPT5 S327A
Plasmid#27271DepositorAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4 human alpha5 full
Plasmid#221396PurposeMammalian expression of human integrin alpha5 full lengthDepositorInsertintegrin alpha5 full length (ITGA5 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and St…ExpressionMammalianAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT (PGK) NanoLuc
Plasmid#208576PurposeEmpty NanoLuc Lentiviral reporterDepositorInsertsNanoLuciferase
d2eGFP
Empty response element
UseLentiviral, Luciferase, and Synthetic BiologyTags3x SV40 NLS and PESTExpressionMammalianPromoterPGK and miniPAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmiCas9-msa
Plasmid#164833PurposemiCas9-msa fusion protein expressing plasmidDepositorInsertmiCas9-msa
UseCRISPRTagsFLAG and NLSExpressionMammalianMutationcontains mSA sequence range is 5106-5447 and Brex…PromoterCMVAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-Anc689-UdgX-NG-nCas9-RBMX
Plasmid#163554PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-Anc689-UdgX-NG-nCas9-RBMX
UseCRISPRExpressionMammalianMutationnCas9 (D10A)NG (L111R, D1135V, G1218R, E1219F, A1…Available SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only