We narrowed to 7,672 results for: Tet-on
-
Plasmid#158397PurposeGolden Gate entry vector to express the 5th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pYPQ136-tRNA2.0
Plasmid#158398PurposeGolden Gate entry vector to express the 6th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDAI-SceI-SacB
Plasmid#113635PurposeBroad host range replicative plasmid expressing the I-SceI homing endonuclease and the counterselectable marker SacBDepositorInsertsacB
ExpressionBacterialMutationPlease see Depositor CommentsPromotersacB promoterAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pKIR1.1
Plasmid#85758PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporterDepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAGExpressionPlantPromoterAtRPS5AAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B2.0
Plasmid#99888PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131B2.0
Plasmid#99885PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC-crRNA-Km
Plasmid#158712PurposePlasmids containing the medium-copy-number p15A origin of replication can be propagated in E. coli cells and a non-targeting crRNADepositorInsertAcGFP (for crRNA cloning)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterTetOAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-hM3Dq-mCherry
Plasmid#166599PurposeEncodes Cre-dependent hM3Dq-mCherry under control of the TREDepositorInserthM3Dq-mCherry
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B2.0
Plasmid#99892PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-eGFP
Plasmid#157733Purposemammalian expression of untagged eGFP under control of a tetracycline-inducible promoterDepositorInserteGFP
ExpressionMammalianAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJK02
Plasmid#105133PurposeClostridium difficile CRISPR-cas9 mutagenesis plasmid traJ oriTDepositorInsertsUpstream & Downstream pyrE deletion region
tetR
Cas9
gRNA
UseE. coli - c. difficile shuttle vectorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::rtTA3-bGHpA
Plasmid#62445PurposeMXS_chaining vector with CMV::rtTA3-bGHpADepositorInsertcassette containing the reverse tetracycline transactivator with CMV promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSW002-PpsbA
Plasmid#108236PurposeBroad host bacterial expression vector with constitutive PsbA promoterDepositorInsertPsbA promoter
ExpressionBacterialAvailable SinceMay 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2H12Matry
Plasmid#221143PurposecdGreen-Matry expressed from an aTc-inducible promoter (Internal Lab ID: UJ11208)DepositorInsertcdGreen-Matry
ExpressionBacterialPromoterPtetAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLD3 translation factors
Plasmid#117762PurposeBioBrick encoding cistrons 22-30 in pET for preparation of PURE 3.0 translation system from E. coliDepositorInsertTranslation factor cistrons 22-30
UseEscherichia coliAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLD2 translation factors
Plasmid#117761PurposeBioBrick encoding cistrons 14-21 in pET for preparation of PURE 3.0 translation system from E. coliDepositorInsertTranslation factor cistrons 14-21
UseEscherichia coliAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTi4.0_SpdCas9_pmcDA1
Plasmid#204613PurposeCRISPR cytosine deaminase integrative plasmid for Mycoplasma gallisepticumDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB237
Plasmid#170030PurposeEncodes LacI-controlled expression of surface-displayed CCL19 and PvirK-mNeonGreen reporterDepositorArticleInsertsUseSynthetic BiologyTagsLpp, OmpA, and TetherExpressionBacterialPromoterPtac and PvirKAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only