We narrowed to 18,438 results for: multi
-
Plasmid#140230PurposeDox inducible expression of luciferase + crIFNg. Constitutive EF1a driven rtTA and GFPDepositorInsertLuciferase + crIFNg (reverse orientation)
UseLentiviralExpressionMammalianPromoterTRE3GAvailable sinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
TK4_SH7_targeting
Plasmid#254454PurposeTK4 targeting vector containing left and right homology arms for the SH7 locusDepositorInsertsmycNLS-mScarlet-T2A-mNeonGreen-PEST
puroR-T2A-mycNLS-mTagBFP2
UsePiggybacTagsPEST, T2A-mycNLS-mTagBFP2, and c-myc-NLSExpressionMammalianPromoterCAG and EF1aAvailable sinceApril 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HaloAKAR2.2-T2A-EGFP
Plasmid#216490PurposeExpression of chemigenetic PKA biosensor (low basal brightness, extremly high dynamic range) and EGFP transfection marker in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHaloAKAR2.2
TagsT2A-EGFPExpressionMammalianPromoterCMVAvailable sinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
TurboID-CRaf
Plasmid#226168PurposeLentiviral plasmid used to express a TurboID fusion of the protein kinase CRaf.DepositorInsertMyc-TurboID-CRaf (RAF1 Human)
UseLentiviralTagsEGFP-IRES-BlastR and Myc-TurboIDExpressionMammalianAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZ403
Plasmid#208113PurposemSwAP-In marker cassette 1 with mScarlet-PuroTKDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmScarlet-PuroTK
TagsP2AExpressionBacterial and MammalianPromoterEF1alphaAvailable sinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-3xFLAG-HSVTKp-mCherry
Plasmid#182377PurposeDual expression construct encoding 3xFLAG and mCherry from separate promotersDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserts3xFlag
mCherry
ExpressionMammalianPromoterHSV TK promoter and SV40 promoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-cGAS-N-HA
Plasmid#130913PurposeExpresses human cGAS N terminus(aa1-159)-HA; Puromycin selection markerDepositorInsertcGAS N terminus
TagsHAExpressionMammalianPromoterCMVAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
"AND-gate" receiver plasmid
Plasmid#127676PurposeEncodes the transcriptional activator LuxR and GFP. LuxR has an pLlacO-1 promoter and the GFP has a pLux promoter.DepositorInsertLuxR, GFP
UseSynthetic BiologyExpressionBacterialPromoterpLlacO-1 for LuxR, pLux for GFPAvailable sinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMyosin-miRFP670nano
Plasmid#127431PurposeLC-Myosin labeling with near-infrared fluorescent protein miRFP670nanoDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmiRFP670nano-LC-Myosin
TagsmiRFP670nanoExpressionMammalianPromoterCMVAvailable sinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC0058 PinCas13 (B02) His6-TwinStrep-SUMO-BsaI
Plasmid#115208PurposeExpresses PinCas13b from a SUMO-tagged bacterial expression constructDepositorInsertPinCas13
TagsSUMOExpressionBacterialAvailable sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC0062 RanCas13 (B06) His6-TwinStrep-SUMO-BsaI
Plasmid#115213PurposeExpresses RanCas13b from a SUMO-tagged bacterial expression constructDepositorInsertRanCas13
TagsSUMOExpressionBacterialAvailable sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACT5FVMF(f)
Plasmid#110549PurposeControl plasmid for titering FV by qPCR to determine the genome-containing particle number. This qPCR protocol is described in Hendrie et al., 2008DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEGFP, FV LTRs
UseQpcr control for titering foamy virusPromoterpromoter: MLV LTRAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
GOMO-GFP-LUC
Plasmid#60976PurposeRapid selection of recombinant marker-free bioluminescent rodent malaria parasitesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGFP-Luciferase fusion
mCherry
hDHFR-yFCU
Available sinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMD19T-psba1-TetR-PL22-dCas9-SpR
Plasmid#73223PurposeContains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorPublicationInsertdCas9 from S. pyogenes
Tagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPL22Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSR02
Plasmid#69149PurposeRead-out loxP mCherry to GFP switch for integration on CxTi10816, Mos chr IVDepositorInsertsmCherry
eGFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterrps-27Available sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMVp-ECFP-Triplex-28-8xmiRNA-BS-28-pA (Construct 22)
Plasmid#55199PurposeCFP reporter along with FF4 miRNA binding sites and 28 nt sequencesDepositorInsertECFP
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable sinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-OeNL(Ca2+)_18μ-pcDNA3
Plasmid#111924PurposeOrange color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of OeNL(Ca2+)_18μDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOeNL(Ca2+)_18μ
TagsCoxVIIIx2ExpressionMammalianMutationE67D, E104D, D133E at CaMPromoterCMVAvailable sinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-Lck-mCherry-ibARK (AAV5)
Viral prep#241241-AAV5PurposeReady-to-use AAV5 particles produced from GfaABC1D-Lck-mCherry-ibARK (#241241). In addition to the viral particles, you will also receive purified GfaABC1D-Lck-mCherry-ibARK plasmid DNA. GfaABC1D-driven expression of Lck-mCherry-ibARK. These AAV preparations are suitable purity for injection into animals.DepositorAvailable sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-PsppA-mCherry
Plasmid#225428PurposePlasmid encodes SgRNA, SpCas9 and homologous arms for homologous recombination of mCherryDepositorInsertmCherry, Cas9, SgRNA
UseCRISPRExpressionBacterialPromoterPsppA upstream of mCherry and Cas9, P3 upstream o…Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only