We narrowed to 10,063 results for: CAG
-
Plasmid#160774PurposeSuppress CISD1DepositorInsertshCISD1_2
UseLentiviralAvailable sinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAmreB
Plasmid#149594Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK2
Plasmid#138696PurposeExpresses a human SIK2-targeting sgRNA and Cas9DepositorAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgMTHFD2L_1
Plasmid#106306PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable sinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgMTHFD2L_2
Plasmid#106307PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable sinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgCIC-2
Plasmid#74967PurposesgCIC-2, puromycin selectionDepositorAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_MBD1_iso1_2
Plasmid#86304PurposeEncodes gRNA for 3' target of human MBD1_iso1DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against MBD1_iso1 (MBD1 Human)
UseCRISPRAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2853-4 pHR: U6-Sasgv2CXCR4-2 CMV-EGFP
Plasmid#84255PurposeExpresses optimized Sa sgCXCR4-2 gRNA with an EGFP fluorescent markerDepositorInsertSa sgCXCR4-2
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJJR50
Plasmid#75026PurposeU6 promoter driven flipped + extended sgRNA expression vectorDepositorInsertguide RNA, flipped and extended version
UseCRISPRPromoterR07E5.16 (U6)Available sinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSuper-Rem2-2
Plasmid#51595PurposeshRNA 2 against rodent Rem2DepositorAvailable sinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Sec6
Plasmid#31118DepositorAvailable sinceSept. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαWT-IRES-EGFP
Plasmid#183456PurposeReplacement of endogenous rat PKA-RIIα subunits with wild-type RIIαDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_pegRNA_(PP7-C4-Q1)
Plasmid#232435PurposepegRNA with optimized 3' modifications to correct the rd12 mutationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-GFP-T(WT)
Plasmid#181736Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available sinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-tDeg
Plasmid#185403PurposeiRFP670-tDeg fluorogenic proteinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertiRFP670-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#2/Cre
Plasmid#173646PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTp53#2/Cre
Plasmid#173621PurposeExpresses a Tp53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tp53 (Trp53 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7
Plasmid#173204PurposeExpresses the ATP1A1 G7 sgRNA in combination with SpCas9 to target ATP1A1 intron 17.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G7 sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only